Incidental Mutation 'R5397:Gm7102'
ID429776
Institutional Source Beutler Lab
Gene Symbol Gm7102
Ensembl Gene ENSMUSG00000094649
Gene Namepredicted gene 7102
Synonyms
MMRRC Submission 042968-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R5397 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location61174686-61176309 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 61175926 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 24 (G24R)
Ref Sequence ENSEMBL: ENSMUSP00000137574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000180168]
Predicted Effect unknown
Transcript: ENSMUST00000180168
AA Change: G24R
SMART Domains Protein: ENSMUSP00000137574
Gene: ENSMUSG00000094649
AA Change: G24R

DomainStartEndE-ValueType
Pfam:MPLKIP 31 170 8.9e-27 PFAM
Meta Mutation Damage Score 0.1094 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acox2 T C 14: 8,243,803 T518A probably benign Het
Acvr1b T A 15: 101,198,964 V254D probably damaging Het
Adar T C 3: 89,735,319 I169T probably benign Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Arap1 A T 7: 101,384,912 Q187L possibly damaging Het
Atad5 T A 11: 80,111,493 M1037K probably damaging Het
Bsg T A 10: 79,708,795 W56R probably damaging Het
C1qtnf3 A G 15: 10,978,541 T276A probably damaging Het
Capn2 A G 1: 182,470,706 C665R probably damaging Het
Cast A G 13: 74,720,937 S248P possibly damaging Het
Cd68 C T 11: 69,665,658 V108I probably benign Het
Cyp2d11 A T 15: 82,392,078 W131R probably damaging Het
Dhx58 A G 11: 100,703,920 V50A probably damaging Het
Fam124a A G 14: 62,606,389 S449G probably benign Het
Flnc G A 6: 29,441,161 M371I possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Gm4787 G C 12: 81,377,830 T518S probably benign Het
Gpr149 A G 3: 62,530,805 S644P probably damaging Het
Gucy1b1 G A 3: 82,044,151 T274I possibly damaging Het
Kcnq5 A G 1: 21,405,856 V541A probably damaging Het
Kdm5b G A 1: 134,622,098 probably null Het
Lig4 G T 8: 9,972,644 R379S probably benign Het
Map7 G A 10: 20,273,321 R514Q unknown Het
Mertk T A 2: 128,771,464 F467I possibly damaging Het
Mettl4 A T 17: 94,727,277 Y463* probably null Het
Nme8 T C 13: 19,694,379 D70G probably damaging Het
Npat A G 9: 53,570,474 N1161D probably damaging Het
Olfr1283 T A 2: 111,368,940 C103S probably benign Het
Olfr616 T A 7: 103,564,506 I258F probably damaging Het
Olfr813 T C 10: 129,856,710 F64S probably damaging Het
Paxip1 A T 5: 27,772,004 probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Plxnc1 T C 10: 94,843,752 T923A probably benign Het
Pms1 T A 1: 53,192,120 K857* probably null Het
Ppp1r9b A G 11: 95,002,110 E260G probably damaging Het
Prpf3 A T 3: 95,853,579 S4T probably benign Het
Rdh14 T A 12: 10,394,869 V240D probably damaging Het
Ripply1 TTCCTCCTCCTCCTCCTCCTCCTCCTCCTCCT TTCCTCCTCCTCCTCCTCCTCCTCCTCCT X: 139,779,850 probably benign Het
S100a1 A T 3: 90,512,135 M1K probably null Het
Slc2a5 G A 4: 150,139,823 probably null Het
Slc5a5 T C 8: 70,891,179 T160A probably damaging Het
Srcap T G 7: 127,553,296 probably null Het
Tcrg-V5 A C 13: 19,192,558 E42D possibly damaging Het
Tgm6 T A 2: 130,141,908 M329K possibly damaging Het
Tom1l1 G A 11: 90,661,774 A201V probably benign Het
Ttc13 T C 8: 124,675,263 T662A possibly damaging Het
Ttn T C 2: 76,725,255 T30469A probably damaging Het
Ube3a T A 7: 59,286,912 S645R probably benign Het
Vgll2 A G 10: 52,025,166 E64G probably damaging Het
Vmn1r25 A T 6: 57,979,075 C76* probably null Het
Vmn2r101 A G 17: 19,588,842 N78D probably damaging Het
Zcchc10 CCAGCAGCAGCAGCAGCAGCAG CCAGCAGCAGCAGCAGCAG 11: 53,332,517 probably benign Het
Zcchc7 C A 4: 44,926,048 A28E probably damaging Het
Other mutations in Gm7102
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01718:Gm7102 APN 19 61175761 missense probably damaging 0.98
IGL02958:Gm7102 APN 19 61175680 missense possibly damaging 0.83
R0427:Gm7102 UTSW 19 61175470 missense probably damaging 1.00
R1886:Gm7102 UTSW 19 61175698 missense probably damaging 0.97
R4576:Gm7102 UTSW 19 61175926 missense unknown
R4578:Gm7102 UTSW 19 61175926 missense unknown
R4615:Gm7102 UTSW 19 61175926 missense unknown
R4616:Gm7102 UTSW 19 61175926 missense unknown
R4617:Gm7102 UTSW 19 61175926 missense unknown
R4621:Gm7102 UTSW 19 61175926 missense unknown
R4622:Gm7102 UTSW 19 61175926 missense unknown
R4623:Gm7102 UTSW 19 61175926 missense unknown
R4826:Gm7102 UTSW 19 61175926 missense unknown
R4827:Gm7102 UTSW 19 61175926 missense unknown
R4829:Gm7102 UTSW 19 61175926 missense unknown
R4830:Gm7102 UTSW 19 61175926 missense unknown
R4870:Gm7102 UTSW 19 61175926 missense unknown
R4871:Gm7102 UTSW 19 61175926 missense unknown
R4951:Gm7102 UTSW 19 61175926 missense unknown
R5112:Gm7102 UTSW 19 61175926 missense unknown
R5301:Gm7102 UTSW 19 61175926 missense unknown
R5317:Gm7102 UTSW 19 61175926 missense unknown
R5335:Gm7102 UTSW 19 61175926 missense unknown
R5399:Gm7102 UTSW 19 61175926 missense unknown
R5591:Gm7102 UTSW 19 61175926 missense unknown
R5592:Gm7102 UTSW 19 61175926 missense unknown
R5594:Gm7102 UTSW 19 61175926 missense unknown
R5616:Gm7102 UTSW 19 61175926 missense unknown
R5884:Gm7102 UTSW 19 61175926 missense unknown
R5919:Gm7102 UTSW 19 61175469 missense probably damaging 1.00
R7003:Gm7102 UTSW 19 61175881 missense possibly damaging 0.93
R7112:Gm7102 UTSW 19 61175559 missense probably damaging 1.00
R7266:Gm7102 UTSW 19 61175535 missense possibly damaging 0.84
Z1177:Gm7102 UTSW 19 61175750 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTAGCCGAACTGATGCTGG -3'
(R):5'- CAGTTGATCGCTGAGGTTCG -3'

Sequencing Primer
(F):5'- AACTGATGCTGGGACCCC -3'
(R):5'- AGGTTCGGCAGTTGAGGC -3'
Posted On2016-09-06