Mutagenetix > Incidental Mutations

Incidental Mutation 'R5461:Crim1'

433050

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

043023-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5461 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 78237807 bp

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Glycine at position 133 (C133G)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

Predicted Effect

probably damaging
Transcript: ENSMUST00000112498
AA Change: C133G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: C133G

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.6698

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.9%

Validation Efficiency

100% (57/57)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930522L14Rik	A	T	5: 109,736,777	I405K	possibly damaging	Het
4930562C15Rik	G	A	16: 4,864,363	G180E	probably damaging	Het
Adgrg6	A	T	10: 14,420,504	W1079R	probably damaging	Het
Arsa	T	C	15: 89,473,275	H495R	probably benign	Het
Bptf	T	C	11: 107,061,764	T2088A	probably damaging	Het
Brsk2	T	C	7: 141,987,906	L152P	probably damaging	Het
C8a	T	C	4: 104,815,845		probably benign	Het
Ccdc177	G	A	12: 80,758,042	A486V	unknown	Het
Cpa2	A	G	6: 30,544,181	T38A	probably benign	Het
Dnah2	C	T	11: 69,473,351		probably null	Het
Ep400	G	A	5: 110,676,684	Q2392*	probably null	Het
Exoc2	C	T	13: 30,925,755	S210N	possibly damaging	Het
Gm7003	A	G	12: 113,803,227		probably benign	Het
Hydin	A	G	8: 110,519,231	K2192R	probably damaging	Het
Ica1l	T	C	1: 60,013,851	D176G	probably damaging	Het
Ints10	G	A	8: 68,794,041	E8K	possibly damaging	Het
Itgb8	T	C	12: 119,168,005	E635G	probably benign	Het
Kmt2d	G	A	15: 98,852,109		probably benign	Het
Kng1	A	G	16: 23,079,137	H429R	probably benign	Het
Mcm3	T	C	1: 20,814,437	I281V	probably benign	Het
Msi1	T	C	5: 115,441,391	S200P	possibly damaging	Het
Nat3	T	C	8: 67,547,862	L131P	probably damaging	Het
Ncor2	T	C	5: 125,027,113	E1752G	probably damaging	Het
Nnt	C	T	13: 119,368,595	A414T	possibly damaging	Het
Nrp2	C	T	1: 62,747,211	Q292*	probably null	Het
Olfr552	G	A	7: 102,604,408	G18D	probably damaging	Het
Olfr615	T	A	7: 103,560,573	L32Q	probably damaging	Het
Otop1	A	T	5: 38,299,715	I273F	probably damaging	Het
Phactr3	T	A	2: 178,278,901	N177K	probably benign	Het
Pik3c2b	C	T	1: 133,099,702	T1313I	possibly damaging	Het
Pikfyve	C	A	1: 65,235,033	D677E	probably damaging	Het
Poc1a	T	C	9: 106,288,010	F157L	probably damaging	Het
Prodh2	G	T	7: 30,494,523	R185L	possibly damaging	Het
Rcc1	T	C	4: 132,334,186	I350M	probably benign	Het
Rhd	G	A	4: 134,884,617	A249T	probably damaging	Het
Rtf2	A	G	2: 172,445,332	Y57C	probably damaging	Het
Shmt1	A	G	11: 60,794,899	S284P	possibly damaging	Het
Shpk	T	C	11: 73,199,535	V6A	probably benign	Het
Slc4a5	T	C	6: 83,285,854	V661A	probably benign	Het
Spesp1	A	T	9: 62,272,732	L298Q	probably damaging	Het
Tas1r2	C	A	4: 139,660,009	Q231K	probably benign	Het
Tcp11l1	T	C	2: 104,688,511	Y280C	probably benign	Het
Tnip1	T	C	11: 54,910,799		probably benign	Het
Topbp1	T	A	9: 103,315,196	D295E	probably benign	Het
Unc79	C	T	12: 103,112,138	L1521F	probably damaging	Het
Usp10	T	C	8: 119,956,667	I759T	probably benign	Het
Vmn1r30	A	T	6: 58,435,774	C24*	probably null	Het
Vmn2r104	T	A	17: 20,030,081	I643F	probably damaging	Het
Wwc1	T	A	11: 35,867,372	T716S	probably damaging	Het
Zfp949	C	T	9: 88,569,484	T369M	probably benign	Het
Zhx3	A	G	2: 160,780,018	V743A	probably benign	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6265:Crim1	UTSW	17	78370085	missense	probably benign	0.01
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	not run
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- CAAATGAAGGCCTCCCATTTG -3'
(R):5'- AGGACTCTTCTAAGGTTGCCC -3'

Sequencing Primer
(F):5'- GGGTGCTGATCTTGACATCCC -3'
(R):5'- CTTGGGAGGCTCAAATGCTATCAC -3'

Posted On

2016-10-06