Mutagenetix > Incidental Mutations

Incidental Mutation 'R6265:Crim1'

506978

Institutional Source

Beutler Lab

Gene Symbol

Crim1

Ensembl Gene

ENSMUSG00000024074

Gene Name

cysteine rich transmembrane BMP regulator 1 (chordin like)

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6265 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

78200248-78376592 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 78370085 bp

Zygosity

Heterozygous

Amino Acid Change

Proline to Leucine at position 905 (P905L)

Ref Sequence

ENSEMBL: ENSMUSP00000108117 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112498]

Predicted Effect

probably benign
Transcript: ENSMUST00000112498
AA Change: P905L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: P905L

Domain	Start	End	E-Value	Type
signal peptide	1	34	N/A	INTRINSIC
IB	35	111	1.87e-5	SMART
VWC	336	390	6.04e-13	SMART
VWC	403	456	1.15e-9	SMART
Pfam:Antistasin	469	498	4.5e-10	PFAM
Pfam:Antistasin	505	532	1.5e-8	PFAM
Pfam:Antistasin	539	564	5.7e-9	PFAM
Pfam:Antistasin	567	592	1.7e-10	PFAM
VWC	608	662	1.26e-10	SMART
VWC	679	734	1.37e-11	SMART
VWC	753	808	1.46e-11	SMART
VWC	819	873	1.01e-14	SMART
transmembrane domain	940	962	N/A	INTRINSIC

Meta Mutation Damage Score

0.1186

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.5%
20x: 95.9%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700013G24Rik	C	T	4: 137,454,675	P47L	probably damaging	Het
Acot1	T	C	12: 84,016,913	I265T	probably benign	Het
Amotl1	T	C	9: 14,571,655	D587G	possibly damaging	Het
Anks1b	T	G	10: 90,941,500	D1117E	probably damaging	Het
Art4	T	G	6: 136,854,888	N85T	probably damaging	Het
Asb3	C	A	11: 31,085,143	Q462K	probably benign	Het
Atcay	C	T	10: 81,213,280	E163K	possibly damaging	Het
Atp6v0e	T	C	17: 26,676,533	V20A	possibly damaging	Het
Atp7b	G	A	8: 22,015,927	Q520*	probably null	Het
Baat	A	T	4: 49,502,836	D95E	possibly damaging	Het
Cars2	TCCCC	TCCC	8: 11,529,599		probably null	Het
Ccdc24	G	A	4: 117,871,177	Q47*	probably null	Het
Cep170b	C	A	12: 112,744,559	Q1488K	probably damaging	Het
Cldn24	A	C	8: 47,822,339	D66A	probably benign	Het
Cln5	C	A	14: 103,073,227	T110K	probably damaging	Het
Clvs2	C	A	10: 33,528,515	S235I	possibly damaging	Het
Col5a3	C	T	9: 20,793,764	G730R	unknown	Het
Cxxc4	T	C	3: 134,258,063	V356A	probably benign	Het
Dctn6	G	T	8: 34,094,903	N93K	probably damaging	Het
Dnah9	G	A	11: 66,168,094	A125V	probably benign	Het
Dnhd1	T	C	7: 105,693,370	I1307T	probably benign	Het
Dpy19l1	T	A	9: 24,432,371	I493F	possibly damaging	Het
Ebf2	A	G	14: 67,424,060	I546V	probably benign	Het
Fbll1	T	C	11: 35,797,809	E209G	probably damaging	Het
Foxj2	G	A	6: 122,828,174	A2T	probably damaging	Het
Foxs1	A	T	2: 152,932,178	C318*	probably null	Het
Gorab	T	C	1: 163,386,630	T244A	possibly damaging	Het
Gtsf1l	C	A	2: 163,087,663		probably benign	Het
Herc1	T	C	9: 66,372,016	S69P	probably benign	Het
Hpca	C	T	4: 129,118,652	W30*	probably null	Het
Ing3	C	A	6: 21,953,814	Q85K	probably damaging	Het
Klhdc8b	T	C	9: 108,448,425	E264G	probably damaging	Het
Lair1	T	A	7: 4,055,827		probably benign	Het
Lama1	T	C	17: 67,750,655	Y575H	probably damaging	Het
Lamtor2	C	A	3: 88,550,713	G29*	probably null	Het
Loxhd1	A	T	18: 77,361,730	D341V	probably damaging	Het
Lrp2	T	A	2: 69,466,340	D3290V	probably damaging	Het
Matn2	A	T	15: 34,399,155	D396V	probably damaging	Het
Me3	T	A	7: 89,849,743	D510E	probably benign	Het
Melk	A	G	4: 44,318,109	Y170C	probably damaging	Het
Mgat2	T	C	12: 69,184,793	V47A	probably benign	Het
Mindy4	T	C	6: 55,301,064	I631T	probably damaging	Het
Myo5b	T	A	18: 74,577,440		probably null	Het
Myo7b	A	T	18: 31,998,150	D521E	probably damaging	Het
Nlrp9b	T	A	7: 20,062,683	F986I	probably benign	Het
Olfr1089	A	G	2: 86,732,955	L219P	probably damaging	Het
Patj	A	G	4: 98,469,567	D690G	probably benign	Het
Pias2	T	C	18: 77,097,258	S5P	probably damaging	Het
Reep4	A	T	14: 70,547,703	S150C	probably damaging	Het
Slc25a21	T	C	12: 57,196,900	R14G	probably benign	Het
Slc6a6	G	C	6: 91,754,915	R575T	probably damaging	Het
Speg	T	A	1: 75,406,679	Y886*	probably null	Het
Tas2r103	A	C	6: 133,036,531	F191V	probably damaging	Het
Tbc1d19	A	G	5: 53,837,924	D145G	probably benign	Het
Tex47	T	A	5: 7,305,461	I214N	probably damaging	Het
Tnnt3	A	T	7: 142,501,645	D3V	probably damaging	Het
Trdv2-1	T	G	14: 53,946,385	S24A	probably benign	Het
Ubr4	A	G	4: 139,452,640	D3377G	possibly damaging	Het
Ugt3a2	A	T	15: 9,361,579	D147V	probably damaging	Het
Usp9y	A	T	Y: 1,446,843	D103E	probably benign	Homo
Vmn1r168	A	G	7: 23,541,536	I273V	probably benign	Het
Vmn2r61	T	C	7: 42,266,491	I176T	probably benign	Het
Vmn2r8	T	A	5: 108,808,597	D53V	probably benign	Het
Zbtb8os	A	T	4: 129,335,982		probably benign	Het
Zfp551	C	T	7: 12,415,412	R690Q	probably damaging	Het

Other mutations in Crim1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00815:Crim1	APN	17	78370091	missense	probably damaging	1.00
IGL01090:Crim1	APN	17	78347229	missense	probably damaging	0.97
IGL01490:Crim1	APN	17	78335296	missense	possibly damaging	0.94
IGL01686:Crim1	APN	17	78344434	missense	probably benign	0.09
IGL01769:Crim1	APN	17	78313235	missense	probably benign	0.02
IGL02004:Crim1	APN	17	78372575	splice site	probably benign
IGL02211:Crim1	APN	17	78355145	missense	probably damaging	1.00
IGL02275:Crim1	APN	17	78369998	missense	possibly damaging	0.56
IGL02408:Crim1	APN	17	78315654	missense	possibly damaging	0.78
IGL02411:Crim1	APN	17	78335334	nonsense	probably null
IGL02453:Crim1	APN	17	78344484	missense	probably damaging	1.00
IGL02481:Crim1	APN	17	78350798	missense	probably damaging	0.98
IGL02632:Crim1	APN	17	78372674	missense	probably benign	0.08
IGL02652:Crim1	APN	17	78315677	missense	probably damaging	1.00
IGL02696:Crim1	APN	17	78279973	missense	probably damaging	0.96
IGL02811:Crim1	APN	17	78350701	missense	possibly damaging	0.62
IGL03105:Crim1	APN	17	78315750	splice site	probably benign
IGL03349:Crim1	APN	17	78355150	nonsense	probably null
bugeye	UTSW	17	78281347	missense	possibly damaging	0.94
IGL03097:Crim1	UTSW	17	78367798	missense	probably benign	0.00
R0227:Crim1	UTSW	17	78344509	splice site	probably benign
R0458:Crim1	UTSW	17	78313226	missense	probably damaging	0.98
R0482:Crim1	UTSW	17	78372579	missense	probably benign	0.00
R0989:Crim1	UTSW	17	78200944	missense	probably benign	0.21
R1266:Crim1	UTSW	17	78200833	small deletion	probably benign
R1529:Crim1	UTSW	17	78367954	missense	probably benign
R1679:Crim1	UTSW	17	78200799	missense	probably benign	0.27
R1909:Crim1	UTSW	17	78313127	missense	probably benign	0.26
R2273:Crim1	UTSW	17	78355179	critical splice donor site	probably null
R3899:Crim1	UTSW	17	78281354	missense	probably benign	0.00
R3909:Crim1	UTSW	17	78281239	splice site	probably benign
R4092:Crim1	UTSW	17	78350836	missense	probably damaging	1.00
R4154:Crim1	UTSW	17	78237843	missense	probably benign	0.01
R4687:Crim1	UTSW	17	78303025	missense	probably damaging	1.00
R5022:Crim1	UTSW	17	78280129	missense	possibly damaging	0.95
R5073:Crim1	UTSW	17	78281347	missense	possibly damaging	0.94
R5089:Crim1	UTSW	17	78374090	missense	probably damaging	1.00
R5284:Crim1	UTSW	17	78313266	missense	possibly damaging	0.83
R5461:Crim1	UTSW	17	78237807	missense	probably damaging	1.00
R5635:Crim1	UTSW	17	78315641	missense	probably damaging	1.00
R5686:Crim1	UTSW	17	78374083	missense	possibly damaging	0.63
R5956:Crim1	UTSW	17	78315717	missense	probably damaging	1.00
R6117:Crim1	UTSW	17	78303088	missense	probably damaging	1.00
R6129:Crim1	UTSW	17	78281309	missense	probably benign	0.17
R6812:Crim1	UTSW	17	78315600	missense	probably damaging	1.00
R6858:Crim1	UTSW	17	78315627	missense	probably damaging	1.00
R7920:Crim1	UTSW	17	78303064	missense	probably damaging	1.00
R8022:Crim1	UTSW	17	78315555	missense	possibly damaging	0.82
R8434:Crim1	UTSW	17	78347257	missense	probably benign	0.00
R8782:Crim1	UTSW	17	78200877	missense	probably damaging	1.00
R8961:Crim1	UTSW	17	78372688	missense	possibly damaging	0.65
X0064:Crim1	UTSW	17	78200833	small deletion	probably benign
Z1088:Crim1	UTSW	17	78367835	missense	probably benign	0.31

Predicted Primers

PCR Primer
(F):5'- GGCCCTGATTGGATAGAGTAC -3'
(R):5'- CAAGGCACATTTACCCAGTGC -3'

Sequencing Primer
(F):5'- GCCCTGATTGGATAGAGTACATTAAC -3'
(R):5'- CAGATCACAAGACAGGACAG -3'

Posted On

2018-03-15