Incidental Mutation 'R6129:Crim1'
ID487597
Institutional Source Beutler Lab
Gene Symbol Crim1
Ensembl Gene ENSMUSG00000024074
Gene Namecysteine rich transmembrane BMP regulator 1 (chordin like)
Synonyms
MMRRC Submission 044276-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6129 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location78200248-78376592 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 78281309 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 271 (D271G)
Ref Sequence ENSEMBL: ENSMUSP00000108117 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112498]
Predicted Effect probably benign
Transcript: ENSMUST00000112498
AA Change: D271G

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108117
Gene: ENSMUSG00000024074
AA Change: D271G

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
IB 35 111 1.87e-5 SMART
VWC 336 390 6.04e-13 SMART
VWC 403 456 1.15e-9 SMART
Pfam:Antistasin 469 498 4.5e-10 PFAM
Pfam:Antistasin 505 532 1.5e-8 PFAM
Pfam:Antistasin 539 564 5.7e-9 PFAM
Pfam:Antistasin 567 592 1.7e-10 PFAM
VWC 608 662 1.26e-10 SMART
VWC 679 734 1.37e-11 SMART
VWC 753 808 1.46e-11 SMART
VWC 819 873 1.01e-14 SMART
transmembrane domain 940 962 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.5%
  • 20x: 95.8%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein containing six cysteine-rich repeat domains and an insulin-like growth factor-binding domain. The encoded protein may play a role in tissue development though interactions with members of the transforming growth factor beta family, such as bone morphogenetic proteins. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mutations in this locus cause perinatal lethality, syndactyly, and eye and kidney abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810408A11Rik T A 11: 69,898,311 Y354F probably damaging Het
Aatk C T 11: 120,021,533 G29S probably damaging Het
Acsm2 G A 7: 119,591,247 probably null Het
Adgrl1 A G 8: 83,918,987 N80D probably damaging Het
Ankrd34a T A 3: 96,597,958 Y159* probably null Het
BC067074 T A 13: 113,368,806 Y2156* probably null Het
Bcl2l2 G A 14: 54,884,745 V122M possibly damaging Het
Brms1l A G 12: 55,868,185 H293R probably benign Het
Clec4b1 A G 6: 123,068,502 T94A possibly damaging Het
Csmd2 G A 4: 128,493,334 G2141S possibly damaging Het
Ctnnal1 C A 4: 56,829,573 A419S possibly damaging Het
Cyp27a1 G A 1: 74,735,692 R264H probably benign Het
Cyr61 T C 3: 145,649,231 I90V possibly damaging Het
Dnase1l1 C T X: 74,277,038 probably null Het
Dsc2 T A 18: 20,045,430 T306S possibly damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A T 19: 29,623,209 Y586N possibly damaging Het
Fbxo6 A T 4: 148,149,522 I39N probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm5114 C T 7: 39,408,600 A532T possibly damaging Het
Gm5431 A G 11: 48,889,591 L168P probably damaging Het
Hao2 T C 3: 98,880,526 T196A probably benign Het
Hdac9 A C 12: 34,287,475 L669R probably damaging Het
Hps5 A G 7: 46,771,774 V755A probably benign Het
Jag2 G T 12: 112,920,349 Y203* probably null Het
Lrrn3 G A 12: 41,453,788 Q177* probably null Het
Me1 A T 9: 86,650,956 V151E probably damaging Het
Mkx A G 18: 6,992,888 V132A probably damaging Het
Mycbp2 A G 14: 103,285,400 S643P probably benign Het
Mysm1 C A 4: 94,967,955 R135L probably damaging Het
Nup210l T C 3: 90,104,176 F4L probably benign Het
Pappa2 A T 1: 158,714,997 C1773* probably null Het
Pcbp3 T C 10: 76,763,348 E318G probably damaging Het
Pcdh12 T C 18: 38,277,859 K984E probably damaging Het
Pcna-ps2 A G 19: 9,284,015 N213D possibly damaging Het
Pde8b G A 13: 95,041,959 A509V probably damaging Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Phf7 A G 14: 31,240,863 Y137H probably damaging Het
Pkd1l1 A G 11: 8,868,543 V1315A probably benign Het
Plxnd1 A G 6: 115,978,174 C571R probably damaging Het
Ppp1r12b C T 1: 134,892,252 W251* probably null Het
Prps1l1 A G 12: 34,985,330 E148G probably damaging Het
Robo1 A T 16: 73,013,068 M1235L probably benign Het
Robo3 A G 9: 37,423,293 Y592H probably benign Het
Rsrc1 C T 3: 66,994,649 P44L unknown Het
Rufy1 A T 11: 50,417,248 L259Q probably damaging Het
Rusc2 T C 4: 43,424,271 F1112S probably damaging Het
Sap130 T C 18: 31,682,091 V622A possibly damaging Het
Sptbn4 C A 7: 27,360,088 C1124F probably damaging Het
Stk10 T A 11: 32,615,871 C872S probably damaging Het
Tex15 A T 8: 33,574,130 N1196I possibly damaging Het
Tnxa A G 17: 34,800,288 probably benign Het
Zfp647 G A 15: 76,912,085 P125L probably damaging Het
Zscan4b T A 7: 10,901,888 T171S probably benign Het
Other mutations in Crim1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Crim1 APN 17 78370091 missense probably damaging 1.00
IGL01090:Crim1 APN 17 78347229 missense probably damaging 0.97
IGL01490:Crim1 APN 17 78335296 missense possibly damaging 0.94
IGL01686:Crim1 APN 17 78344434 missense probably benign 0.09
IGL01769:Crim1 APN 17 78313235 missense probably benign 0.02
IGL02004:Crim1 APN 17 78372575 splice site probably benign
IGL02211:Crim1 APN 17 78355145 missense probably damaging 1.00
IGL02275:Crim1 APN 17 78369998 missense possibly damaging 0.56
IGL02408:Crim1 APN 17 78315654 missense possibly damaging 0.78
IGL02411:Crim1 APN 17 78335334 nonsense probably null
IGL02453:Crim1 APN 17 78344484 missense probably damaging 1.00
IGL02481:Crim1 APN 17 78350798 missense probably damaging 0.98
IGL02632:Crim1 APN 17 78372674 missense probably benign 0.08
IGL02652:Crim1 APN 17 78315677 missense probably damaging 1.00
IGL02696:Crim1 APN 17 78279973 missense probably damaging 0.96
IGL02811:Crim1 APN 17 78350701 missense possibly damaging 0.62
IGL03105:Crim1 APN 17 78315750 splice site probably benign
IGL03349:Crim1 APN 17 78355150 nonsense probably null
bugeye UTSW 17 78281347 missense possibly damaging 0.94
IGL03097:Crim1 UTSW 17 78367798 missense probably benign 0.00
R0227:Crim1 UTSW 17 78344509 splice site probably benign
R0458:Crim1 UTSW 17 78313226 missense probably damaging 0.98
R0482:Crim1 UTSW 17 78372579 missense probably benign 0.00
R0989:Crim1 UTSW 17 78200944 missense probably benign 0.21
R1266:Crim1 UTSW 17 78200833 small deletion probably benign
R1529:Crim1 UTSW 17 78367954 missense probably benign
R1679:Crim1 UTSW 17 78200799 missense probably benign 0.27
R1909:Crim1 UTSW 17 78313127 missense probably benign 0.26
R2273:Crim1 UTSW 17 78355179 critical splice donor site probably null
R3899:Crim1 UTSW 17 78281354 missense probably benign 0.00
R3909:Crim1 UTSW 17 78281239 splice site probably benign
R4092:Crim1 UTSW 17 78350836 missense probably damaging 1.00
R4154:Crim1 UTSW 17 78237843 missense probably benign 0.01
R4687:Crim1 UTSW 17 78303025 missense probably damaging 1.00
R5022:Crim1 UTSW 17 78280129 missense possibly damaging 0.95
R5073:Crim1 UTSW 17 78281347 missense possibly damaging 0.94
R5089:Crim1 UTSW 17 78374090 missense probably damaging 1.00
R5284:Crim1 UTSW 17 78313266 missense possibly damaging 0.83
R5461:Crim1 UTSW 17 78237807 missense probably damaging 1.00
R5635:Crim1 UTSW 17 78315641 missense probably damaging 1.00
R5686:Crim1 UTSW 17 78374083 missense possibly damaging 0.63
R5956:Crim1 UTSW 17 78315717 missense probably damaging 1.00
R6117:Crim1 UTSW 17 78303088 missense probably damaging 1.00
R6265:Crim1 UTSW 17 78370085 missense probably benign 0.01
R6812:Crim1 UTSW 17 78315600 missense probably damaging 1.00
R6858:Crim1 UTSW 17 78315627 missense probably damaging 1.00
R7920:Crim1 UTSW 17 78303064 missense probably damaging 1.00
R8022:Crim1 UTSW 17 78315555 missense possibly damaging 0.82
R8434:Crim1 UTSW 17 78347257 missense probably benign 0.00
X0064:Crim1 UTSW 17 78200833 small deletion probably benign
Z1088:Crim1 UTSW 17 78367835 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- AGACATACCCCGATTGTGGAAC -3'
(R):5'- CAGGATTGAGTTTCCCAAGGG -3'

Sequencing Primer
(F):5'- AGAACCTTGGATGGGCCCTG -3'
(R):5'- TCCCAAGGGAAAGCAAGCTG -3'
Posted On2017-10-10