Incidental Mutation 'R5471:Exoc6'
ID433841
Institutional Source Beutler Lab
Gene Symbol Exoc6
Ensembl Gene ENSMUSG00000053799
Gene Nameexocyst complex component 6
Synonymsmsec15, Sec15l1, 4833405E05Rik, Sec15, hbd
MMRRC Submission 043032-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5471 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location37550418-37683245 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37599617 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 566 (D566G)
Ref Sequence ENSEMBL: ENSMUSP00000064332 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066439]
Predicted Effect probably benign
Transcript: ENSMUST00000066439
AA Change: D566G

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000064332
Gene: ENSMUSG00000053799
AA Change: D566G

DomainStartEndE-ValueType
low complexity region 265 273 N/A INTRINSIC
Pfam:Sec15 456 762 8.1e-109 PFAM
Meta Mutation Damage Score 0.1076 question?
Coding Region Coverage
  • 1x: 98.2%
  • 3x: 97.3%
  • 10x: 95.1%
  • 20x: 90.5%
Validation Efficiency 96% (67/70)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to the Saccharomyces cerevisiae SEC15 gene product, which is essential for vesicular traffic from the Golgi apparatus to the cell surface in yeast. It is one of the components of a multiprotein complex required for exocytosis. The 5' portion of this gene and two neighboring cytochrome p450 genes are included in a deletion that results in an autosomal-dominant form of nonsyndromic optic nerve aplasia (ONA). Alternative splicing and the use of alternative promoters results in multiple transcript variants. A paralogous gene encoding a similar protein is present on chromosome 2. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit severe microcytic anemia, erythrocyte hyperchromia, and markedly increased levels of red cell protoporphyrin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 C T 7: 119,660,606 H493Y probably damaging Het
Alox12e T C 11: 70,320,024 I290V probably benign Het
Ankfy1 T A 11: 72,728,791 N163K probably benign Het
Baiap2l1 T G 5: 144,282,141 N219T probably benign Het
Cd72 T C 4: 43,448,345 I312V probably benign Het
Cfap54 A T 10: 93,028,660 M139K probably damaging Het
Clec4n T A 6: 123,232,186 M70K probably benign Het
Cwh43 T A 5: 73,408,231 C46* probably null Het
Cyp1a2 A T 9: 57,679,020 I405N probably damaging Het
Dlc1 G T 8: 36,584,725 S617R probably benign Het
Eif2ak4 A G 2: 118,474,132 N1546S probably benign Het
Elmo1 A G 13: 20,572,385 I548V probably benign Het
Fam20b T C 1: 156,705,729 T106A probably damaging Het
Fam83h T C 15: 76,002,903 T862A probably benign Het
Fgfr1op2 A T 6: 146,597,362 probably null Het
Gcnt2 A G 13: 40,860,719 Y122C probably damaging Het
Gm11992 A T 11: 9,068,333 probably null Het
Gm15922 T A 7: 3,735,515 I621F probably benign Het
Gm5114 C A 7: 39,409,110 E362* probably null Het
Gm815 A G 19: 26,888,369 T96A unknown Het
Gm8674 A G 13: 49,900,813 noncoding transcript Het
Gnat3 T A 5: 17,991,324 I56N probably damaging Het
Gpr1 A C 1: 63,183,899 V59G probably damaging Het
Igkv1-133 T C 6: 67,725,547 V83A probably benign Het
Mrgprb8 T A 7: 48,388,723 N47K probably damaging Het
Nav2 A G 7: 49,548,169 D1182G probably damaging Het
Neto2 T C 8: 85,640,760 T480A probably benign Het
Npnt T G 3: 132,914,387 N115T probably benign Het
Nr1h5 T C 3: 102,949,126 N279S possibly damaging Het
Ntrk2 T C 13: 58,871,760 V395A probably benign Het
Olfr205 T G 16: 59,328,631 N293H probably damaging Het
Olfr319 T C 11: 58,702,325 L208S probably damaging Het
Olfr802 A G 10: 129,682,056 S228P probably damaging Het
Padi2 A G 4: 140,933,208 K333R possibly damaging Het
Ptgis C A 2: 167,224,119 M130I probably benign Het
Ptpn4 A T 1: 119,765,919 Y124* probably null Het
Saal1 C T 7: 46,699,648 V281M probably benign Het
Saxo1 G A 4: 86,445,724 T174I probably damaging Het
Slc7a12 G A 3: 14,480,875 V27M probably damaging Het
Slco4c1 C A 1: 96,872,045 R22L probably benign Het
Slfn9 T G 11: 82,982,787 Q430P possibly damaging Het
Slit2 T A 5: 48,189,555 N246K probably damaging Het
Stox2 G T 8: 47,193,513 T304K probably damaging Het
Tmem87b T G 2: 128,851,320 F542V possibly damaging Het
Topaz1 T G 9: 122,791,416 probably null Het
Trappc12 G A 12: 28,691,500 R737W probably damaging Het
Trim9 A G 12: 70,346,792 I126T possibly damaging Het
Txnl1 A G 18: 63,676,926 C149R probably damaging Het
Ubald1 G A 16: 4,875,841 T70M probably damaging Het
Vash1 G A 12: 86,689,128 V263M possibly damaging Het
Vsx1 T C 2: 150,683,066 T343A probably benign Het
Zfp397 A G 18: 23,960,024 N189D probably benign Het
Other mutations in Exoc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01432:Exoc6 APN 19 37589876 missense possibly damaging 0.68
IGL01716:Exoc6 APN 19 37682964 missense probably damaging 0.98
IGL02363:Exoc6 APN 19 37608954 missense probably damaging 1.00
IGL02383:Exoc6 APN 19 37578474 missense probably benign
IGL03394:Exoc6 APN 19 37599572 missense probably benign 0.15
australamerican UTSW 19 37598679 critical splice donor site probably null
IGL03046:Exoc6 UTSW 19 37593769 critical splice donor site probably null
R1156:Exoc6 UTSW 19 37682897 missense probably benign 0.05
R1489:Exoc6 UTSW 19 37597120 missense possibly damaging 0.71
R1747:Exoc6 UTSW 19 37639769 splice site probably null
R2125:Exoc6 UTSW 19 37590941 missense probably damaging 1.00
R2863:Exoc6 UTSW 19 37653413 missense probably benign 0.34
R4090:Exoc6 UTSW 19 37571912 missense probably benign
R4666:Exoc6 UTSW 19 37570505 missense probably damaging 0.97
R4674:Exoc6 UTSW 19 37609082 missense probably damaging 1.00
R5382:Exoc6 UTSW 19 37598679 critical splice donor site probably null
R5533:Exoc6 UTSW 19 37593770 splice site probably null
R5607:Exoc6 UTSW 19 37578529 missense probably benign 0.01
R5641:Exoc6 UTSW 19 37587633 splice site probably null
R5759:Exoc6 UTSW 19 37573741 nonsense probably null
R5889:Exoc6 UTSW 19 37582245 missense probably damaging 1.00
R6592:Exoc6 UTSW 19 37571912 missense probably benign
R6936:Exoc6 UTSW 19 37571863 missense probably benign 0.00
R6988:Exoc6 UTSW 19 37609091 missense probably damaging 1.00
R7088:Exoc6 UTSW 19 37577010 missense probably damaging 0.99
R7162:Exoc6 UTSW 19 37577118 missense probably damaging 0.97
R7948:Exoc6 UTSW 19 37576974 missense probably benign 0.00
R8266:Exoc6 UTSW 19 37577049 missense probably benign 0.00
R8525:Exoc6 UTSW 19 37608992 missense possibly damaging 0.53
RF009:Exoc6 UTSW 19 37571620 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GAAATCAGTTATATCCTGTCTTGCTGG -3'
(R):5'- AACTGACAGTCATCACAGGC -3'

Sequencing Primer
(F):5'- CCTGTCTTGCTGGAATTATACAG -3'
(R):5'- CAGGCAATGATTACCTGTGATGCTC -3'
Posted On2016-10-06