Incidental Mutation 'R5689:Cfb'
ID443601
Institutional Source Beutler Lab
Gene Symbol Cfb
Ensembl Gene ENSMUSG00000090231
Gene Namecomplement factor B
SynonymsFB, Factor B, B, alternative-complement pathway C3/C5 convertase, Bf, H2-Bf
MMRRC Submission 043322-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5689 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34856374-34862518 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34861794 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 76 (T76S)
Ref Sequence ENSEMBL: ENSMUSP00000120990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025229] [ENSMUST00000025230] [ENSMUST00000128767] [ENSMUST00000146299] [ENSMUST00000148431] [ENSMUST00000152417] [ENSMUST00000153400] [ENSMUST00000176203] [ENSMUST00000154526]
Predicted Effect probably benign
Transcript: ENSMUST00000025229
AA Change: T78S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000025229
Gene: ENSMUSG00000090231
AA Change: T78S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 751 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000025230
SMART Domains Protein: ENSMUSP00000025230
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Blast:CCP 22 71 8e-24 BLAST
low complexity region 72 83 N/A INTRINSIC
CCP 94 149 1.34e-11 SMART
CCP 156 210 1.89e-11 SMART
Blast:VWA 219 245 1e-7 BLAST
VWA 259 464 1.32e-31 SMART
Tryp_SPc 468 747 4.43e-26 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127795
Predicted Effect probably benign
Transcript: ENSMUST00000128767
AA Change: T76S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000119977
Gene: ENSMUSG00000090231
AA Change: T76S

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 749 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000129891
SMART Domains Protein: ENSMUSP00000120864
Gene: ENSMUSG00000092511

DomainStartEndE-ValueType
Blast:VWA 2 77 8e-7 BLAST
Tryp_SPc 85 365 5.69e-8 SMART
CCP 310 365 4.62e-15 SMART
CCP 372 425 2.06e-12 SMART
VWA 475 680 1.07e-40 SMART
Tryp_SPc 688 959 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000133127
SMART Domains Protein: ENSMUSP00000118360
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
PDB:2WIN|L 2 43 2e-20 PDB
Blast:VWA 13 44 9e-11 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000134300
SMART Domains Protein: ENSMUSP00000114241
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
Tryp_SPc 3 148 6.48e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000141295
SMART Domains Protein: ENSMUSP00000118945
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 18 258 3.76e-7 SMART
Predicted Effect unknown
Transcript: ENSMUST00000146299
AA Change: T591S
SMART Domains Protein: ENSMUSP00000117677
Gene: ENSMUSG00000092511
AA Change: T591S

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 72 83 N/A INTRINSIC
CCP 94 148 1.89e-11 SMART
VWA 103 311 1.74e-1 SMART
Tryp_SPc 315 547 1.49e-7 SMART
CCP 549 601 5.15e-1 SMART
CCP 615 670 4.62e-15 SMART
CCP 677 730 2.06e-12 SMART
VWA 780 985 1.07e-40 SMART
Tryp_SPc 993 1264 2.53e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000148431
SMART Domains Protein: ENSMUSP00000120009
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
VWA 33 187 2.33e0 SMART
Tryp_SPc 191 470 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152417
SMART Domains Protein: ENSMUSP00000123536
Gene: ENSMUSG00000024371

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
CCP 19 73 1.89e-11 SMART
Blast:VWA 82 108 2e-7 BLAST
VWA 122 327 1.32e-31 SMART
Tryp_SPc 331 610 4.43e-26 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000153400
SMART Domains Protein: ENSMUSP00000116497
Gene: ENSMUSG00000090231

DomainStartEndE-ValueType
Tryp_SPc 1 217 2.36e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176203
AA Change: T78S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000135660
Gene: ENSMUSG00000090231
AA Change: T78S

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
CCP 36 88 5.15e-1 SMART
CCP 102 157 4.62e-15 SMART
CCP 164 217 2.06e-12 SMART
VWA 267 472 1.07e-40 SMART
Tryp_SPc 480 713 5.03e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000154526
AA Change: T76S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000120990
Gene: ENSMUSG00000090231
AA Change: T76S

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
CCP 34 86 5.15e-1 SMART
CCP 100 155 4.62e-15 SMART
CCP 162 215 2.06e-12 SMART
VWA 265 470 1.07e-40 SMART
Tryp_SPc 478 711 5.03e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184774
Predicted Effect probably benign
Transcript: ENSMUST00000176332
Meta Mutation Damage Score 0.0721 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.8%
  • 10x: 97.5%
  • 20x: 95.8%
Validation Efficiency 95% (63/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes complement factor B, a component of the alternative pathway of complement activation. Factor B circulates in the blood as a single chain polypeptide. Upon activation of the alternative pathway, it is cleaved by complement factor D yielding the noncatalytic chain Ba and the catalytic subunit Bb. The active subunit Bb is a serine protease which associates with C3b to form the alternative pathway C3 convertase. Bb is involved in the proliferation of preactivated B lymphocytes, while Ba inhibits their proliferation. This gene localizes to the major histocompatibility complex (MHC) class III region on chromosome 6. This cluster includes several genes involved in regulation of the immune reaction. Polymorphisms in this gene are associated with a reduced risk of age-related macular degeneration. The polyadenylation site of this gene is 421 bp from the 5' end of the gene for complement component 2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations lack the alternative complement pathway, and have reduced overall complement activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy7 G T 8: 88,324,784 C844F probably benign Het
Afdn T C 17: 13,855,359 V945A probably damaging Het
Aimp2 T C 5: 143,906,571 D67G possibly damaging Het
Aqp7 G A 4: 41,035,510 T115I probably benign Het
Atp11b G T 3: 35,834,352 V924F possibly damaging Het
Atp8b1 C T 18: 64,564,537 R412H probably damaging Het
Cmpk2 A T 12: 26,469,767 H139L probably benign Het
Cypt4 T C 9: 24,625,246 S11P possibly damaging Het
Dbx1 A G 7: 49,632,771 F229L probably damaging Het
Dnah6 T A 6: 73,021,227 M4071L probably benign Het
Dnah7a A G 1: 53,405,698 V3949A possibly damaging Het
Dnajc25 A G 4: 59,017,716 E6G probably damaging Het
Dync2h1 C A 9: 7,169,689 V263F probably damaging Het
Eno4 T A 19: 58,970,656 D403E probably benign Het
Evi5l C T 8: 4,205,460 Q542* probably null Het
Fam135a A G 1: 24,029,053 S12P probably benign Het
Fam198a T C 9: 121,965,688 F303L probably damaging Het
Flnc G A 6: 29,441,592 A458T probably benign Het
Fnip1 T C 11: 54,502,289 V517A probably damaging Het
Galc G T 12: 98,212,986 H361N possibly damaging Het
Gcnt1 T A 19: 17,329,404 D319V probably damaging Het
Gm26996 T C 6: 130,578,295 noncoding transcript Het
Gm5321 A T 7: 6,019,269 noncoding transcript Het
Grin3b T C 10: 79,974,631 L657P probably damaging Het
Gstm5 T C 3: 107,896,665 F54S probably damaging Het
Ilk C A 7: 105,741,650 L267I probably benign Het
Lifr A G 15: 7,184,804 Y713C probably damaging Het
Lnx2 A T 5: 147,029,151 V386E probably damaging Het
Lrch1 T C 14: 74,786,324 E587G probably damaging Het
Olfr1512 C T 14: 52,372,757 V99M possibly damaging Het
Osgin1 A G 8: 119,444,989 *173W probably null Het
Pcdhga7 C A 18: 37,716,683 P581H probably damaging Het
Pde4dip A T 3: 97,692,367 L2384* probably null Het
Phf12 T A 11: 78,023,725 N115K probably damaging Het
Pmel A G 10: 128,716,301 T335A probably damaging Het
Polr3e C A 7: 120,940,689 T579K possibly damaging Het
Ptprc A G 1: 138,117,777 V164A probably benign Het
Rapsn T C 2: 91,035,924 F43S probably damaging Het
Rarb T A 14: 16,434,177 I334F probably damaging Het
Rev3l T C 10: 39,794,958 Y167H probably damaging Het
Rnf146 T C 10: 29,347,804 T29A probably benign Het
Rsf1 GC GCGGCGGCGCC 7: 97,579,934 probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Slc5a10 C T 11: 61,707,884 M223I probably benign Het
Slc7a11 C G 3: 50,372,331 V494L probably benign Het
Slitrk6 C T 14: 110,752,126 E50K probably benign Het
Smg8 A G 11: 87,085,123 F544S probably damaging Het
Tnpo3 T C 6: 29,571,064 M444V possibly damaging Het
Trav7d-4 G A 14: 52,770,194 R48H probably damaging Het
Trim50 A T 5: 135,353,662 T123S probably damaging Het
Trpc4ap C G 2: 155,671,035 probably null Het
Ttn T A 2: 76,788,276 R14475S probably damaging Het
Uts2 A T 4: 150,999,108 T59S possibly damaging Het
Vmn1r52 T C 6: 90,179,250 S179P possibly damaging Het
Vmn2r116 A G 17: 23,397,719 H537R probably benign Het
Vps16 C T 2: 130,439,091 Q226* probably null Het
Zfhx2 T C 14: 55,073,903 T445A possibly damaging Het
Zfp638 T C 6: 83,929,072 V73A probably damaging Het
Other mutations in Cfb
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0270:Cfb UTSW 17 34860386 missense possibly damaging 0.92
R0419:Cfb UTSW 17 34858509 missense probably damaging 1.00
R0514:Cfb UTSW 17 34860898 missense probably damaging 1.00
R0645:Cfb UTSW 17 34860016 missense probably benign 0.25
R0668:Cfb UTSW 17 34857103 missense probably benign 0.29
R0893:Cfb UTSW 17 34858055 missense probably damaging 1.00
R1879:Cfb UTSW 17 34860560 missense probably benign 0.11
R2135:Cfb UTSW 17 34857278 missense possibly damaging 0.84
R3107:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R4291:Cfb UTSW 17 34861138 missense possibly damaging 0.95
R4369:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4371:Cfb UTSW 17 34860314 missense probably damaging 1.00
R4616:Cfb UTSW 17 34859068 missense probably benign 0.29
R5177:Cfb UTSW 17 34859026 missense probably damaging 1.00
R5773:Cfb UTSW 17 34857272 nonsense probably null
R6046:Cfb UTSW 17 34862102 splice site probably null
R6274:Cfb UTSW 17 34862093 missense probably benign 0.18
R6318:Cfb UTSW 17 34861824 missense possibly damaging 0.88
R7035:Cfb UTSW 17 34860031 missense possibly damaging 0.53
R7585:Cfb UTSW 17 34857761 missense probably benign 0.00
R7920:Cfb UTSW 17 34860891 missense probably benign 0.00
R8312:Cfb UTSW 17 34858145 missense probably benign 0.11
RF005:Cfb UTSW 17 34858046 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- TTTTCACTGCCCGAGGAAAG -3'
(R):5'- ACTAGACTTTCTCCTCAGGTGTG -3'

Sequencing Primer
(F):5'- TGTGCCTGTGCTCAACCAG -3'
(R):5'- TCAGGTGTGAGCGCAACTC -3'
Posted On2016-11-09