Mutagenetix > Incidental Mutations

Incidental Mutation 'R5689:Slitrk6'

443596

Institutional Source

Beutler Lab

Gene Symbol

Slitrk6

Ensembl Gene

ENSMUSG00000045871

Gene Name

SLIT and NTRK-like family, member 6

Synonyms

4832410J21Rik

MMRRC Submission

043322-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.183) question?

Stock #

R5689 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

110748580-110755149 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 110752126 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 50 (E50K)

Ref Sequence

ENSEMBL: ENSMUSP00000077492 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078386]

Predicted Effect

probably benign
Transcript: ENSMUST00000078386
AA Change: E50K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000077492
Gene: ENSMUSG00000045871
AA Change: E50K

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
Blast:LRRNT	30	68	4e-15	BLAST
LRR	87	110	1.71e1	SMART
LRR	111	134	3.07e-1	SMART
LRR	135	158	4.44e0	SMART
LRR_TYP	159	182	2.09e-3	SMART
LRR	185	206	6.23e1	SMART
LRRCT	218	268	5.61e-5	SMART
low complexity region	287	301	N/A	INTRINSIC
Blast:LRRNT	327	364	2e-17	BLAST
LRR	388	408	2.68e1	SMART
LRR_TYP	409	432	3.63e-3	SMART
LRR_TYP	433	456	6.23e-2	SMART
LRR_TYP	457	480	3.69e-4	SMART
low complexity region	501	513	N/A	INTRINSIC
LRRCT	516	566	1.53e-6	SMART
transmembrane domain	610	632	N/A	INTRINSIC
low complexity region	634	642	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.5%
3x: 98.8%
10x: 97.5%
20x: 95.8%

Validation Efficiency

95% (63/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the SLITRK protein family. Members of this family are integral membrane proteins that are characterized by two N-terminal leucine-rich repeat (LRR) domains and a C-terminal region that shares homology with trk neurotrophin receptors. This protein functions as a regulator of neurite outgrowth required for normal hearing and vision. Mutations in this gene are a cause of myopia and deafness. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous deficient mice show pronounced reduction in cochlear innervation. Innervation to the posterior crista is variably impaired and a there is a loss of neurons in the spiral and vestibular ganglia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 58 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adcy7	G	T	8: 88,324,784	C844F	probably benign	Het
Afdn	T	C	17: 13,855,359	V945A	probably damaging	Het
Aimp2	T	C	5: 143,906,571	D67G	possibly damaging	Het
Aqp7	G	A	4: 41,035,510	T115I	probably benign	Het
Atp11b	G	T	3: 35,834,352	V924F	possibly damaging	Het
Atp8b1	C	T	18: 64,564,537	R412H	probably damaging	Het
Cfb	T	A	17: 34,861,794	T76S	probably benign	Het
Cmpk2	A	T	12: 26,469,767	H139L	probably benign	Het
Cypt4	T	C	9: 24,625,246	S11P	possibly damaging	Het
Dbx1	A	G	7: 49,632,771	F229L	probably damaging	Het
Dnah6	T	A	6: 73,021,227	M4071L	probably benign	Het
Dnah7a	A	G	1: 53,405,698	V3949A	possibly damaging	Het
Dnajc25	A	G	4: 59,017,716	E6G	probably damaging	Het
Dync2h1	C	A	9: 7,169,689	V263F	probably damaging	Het
Eno4	T	A	19: 58,970,656	D403E	probably benign	Het
Evi5l	C	T	8: 4,205,460	Q542*	probably null	Het
Fam135a	A	G	1: 24,029,053	S12P	probably benign	Het
Fam198a	T	C	9: 121,965,688	F303L	probably damaging	Het
Flnc	G	A	6: 29,441,592	A458T	probably benign	Het
Fnip1	T	C	11: 54,502,289	V517A	probably damaging	Het
Galc	G	T	12: 98,212,986	H361N	possibly damaging	Het
Gcnt1	T	A	19: 17,329,404	D319V	probably damaging	Het
Gm26996	T	C	6: 130,578,295		noncoding transcript	Het
Gm5321	A	T	7: 6,019,269		noncoding transcript	Het
Grin3b	T	C	10: 79,974,631	L657P	probably damaging	Het
Gstm5	T	C	3: 107,896,665	F54S	probably damaging	Het
Ilk	C	A	7: 105,741,650	L267I	probably benign	Het
Lifr	A	G	15: 7,184,804	Y713C	probably damaging	Het
Lnx2	A	T	5: 147,029,151	V386E	probably damaging	Het
Lrch1	T	C	14: 74,786,324	E587G	probably damaging	Het
Olfr1512	C	T	14: 52,372,757	V99M	possibly damaging	Het
Osgin1	A	G	8: 119,444,989	*173W	probably null	Het
Pcdhga7	C	A	18: 37,716,683	P581H	probably damaging	Het
Pde4dip	A	T	3: 97,692,367	L2384*	probably null	Het
Phf12	T	A	11: 78,023,725	N115K	probably damaging	Het
Pmel	A	G	10: 128,716,301	T335A	probably damaging	Het
Polr3e	C	A	7: 120,940,689	T579K	possibly damaging	Het
Ptprc	A	G	1: 138,117,777	V164A	probably benign	Het
Rapsn	T	C	2: 91,035,924	F43S	probably damaging	Het
Rarb	T	A	14: 16,434,177	I334F	probably damaging	Het
Rev3l	T	C	10: 39,794,958	Y167H	probably damaging	Het
Rnf146	T	C	10: 29,347,804	T29A	probably benign	Het
Rsf1	GC	GCGGCGGCGCC	7: 97,579,934		probably benign	Het
Slc35e2	C	T	4: 155,610,026	P10L	probably benign	Het
Slc5a10	C	T	11: 61,707,884	M223I	probably benign	Het
Slc7a11	C	G	3: 50,372,331	V494L	probably benign	Het
Smg8	A	G	11: 87,085,123	F544S	probably damaging	Het
Tnpo3	T	C	6: 29,571,064	M444V	possibly damaging	Het
Trav7d-4	G	A	14: 52,770,194	R48H	probably damaging	Het
Trim50	A	T	5: 135,353,662	T123S	probably damaging	Het
Trpc4ap	C	G	2: 155,671,035		probably null	Het
Ttn	T	A	2: 76,788,276	R14475S	probably damaging	Het
Uts2	A	T	4: 150,999,108	T59S	possibly damaging	Het
Vmn1r52	T	C	6: 90,179,250	S179P	possibly damaging	Het
Vmn2r116	A	G	17: 23,397,719	H537R	probably benign	Het
Vps16	C	T	2: 130,439,091	Q226*	probably null	Het
Zfhx2	T	C	14: 55,073,903	T445A	possibly damaging	Het
Zfp638	T	C	6: 83,929,072	V73A	probably damaging	Het

Other mutations in Slitrk6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00517:Slitrk6	APN	14	110751115	missense	probably benign	0.35
IGL01131:Slitrk6	APN	14	110751576	missense	probably damaging	1.00
IGL01294:Slitrk6	APN	14	110750074	missense	probably benign
IGL01295:Slitrk6	APN	14	110751436	missense	possibly damaging	0.50
IGL01762:Slitrk6	APN	14	110751624	missense	probably damaging	1.00
IGL02165:Slitrk6	APN	14	110751817	missense	probably benign	0.41
IGL02546:Slitrk6	APN	14	110749794	missense	probably benign	0.18
IGL03103:Slitrk6	APN	14	110749941	missense	probably benign
PIT1430001:Slitrk6	UTSW	14	110750427	missense	possibly damaging	0.93
PIT4480001:Slitrk6	UTSW	14	110749825	frame shift	probably null
R0035:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0066:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0067:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0069:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0107:Slitrk6	UTSW	14	110751963	missense	possibly damaging	0.69
R0157:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0422:Slitrk6	UTSW	14	110752293	start gained	probably benign
R0454:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0505:Slitrk6	UTSW	14	110749932	missense	probably damaging	1.00
R0633:Slitrk6	UTSW	14	110751885	missense	probably damaging	1.00
R0711:Slitrk6	UTSW	14	110749819	missense	probably damaging	1.00
R0843:Slitrk6	UTSW	14	110750098	missense	probably benign
R1298:Slitrk6	UTSW	14	110751865	missense	possibly damaging	0.94
R1693:Slitrk6	UTSW	14	110750928	missense	probably damaging	1.00
R1756:Slitrk6	UTSW	14	110750552	missense	probably benign
R1998:Slitrk6	UTSW	14	110751823	missense	probably damaging	0.99
R2049:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2140:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2142:Slitrk6	UTSW	14	110750794	missense	probably benign	0.00
R2314:Slitrk6	UTSW	14	110751955	missense	probably damaging	1.00
R2566:Slitrk6	UTSW	14	110750272	missense	probably benign	0.00
R4231:Slitrk6	UTSW	14	110751388	missense	probably benign	0.02
R4236:Slitrk6	UTSW	14	110750148	missense	probably benign	0.07
R4247:Slitrk6	UTSW	14	110750739	missense	probably damaging	1.00
R4576:Slitrk6	UTSW	14	110750170	missense	probably benign	0.05
R4856:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4858:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4859:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4860:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4886:Slitrk6	UTSW	14	110751883	missense	probably damaging	1.00
R4931:Slitrk6	UTSW	14	110750379	missense	probably damaging	1.00
R5255:Slitrk6	UTSW	14	110749753	makesense	probably null
R5281:Slitrk6	UTSW	14	110750373	missense	probably damaging	1.00
R5450:Slitrk6	UTSW	14	110750097	missense	probably benign
R5579:Slitrk6	UTSW	14	110751217	missense	possibly damaging	0.82
R5935:Slitrk6	UTSW	14	110749873	missense	probably benign	0.00
R6016:Slitrk6	UTSW	14	110750526	missense	probably benign	0.00
R6312:Slitrk6	UTSW	14	110750247	missense	probably benign	0.00
R6890:Slitrk6	UTSW	14	110751096	nonsense	probably null
R6952:Slitrk6	UTSW	14	110750542	missense	probably benign
R7378:Slitrk6	UTSW	14	110749863	missense	probably damaging	1.00
R8354:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00
R8401:Slitrk6	UTSW	14	110752021	missense	possibly damaging	0.67
R8454:Slitrk6	UTSW	14	110752046	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTGCAAGAATTCCAGGTTC -3'
(R):5'- ACAGAGTCAGATCCAATCATATGAC -3'

Sequencing Primer
(F):5'- GGCCATTAAATGCACCAGTCTCTATG -3'
(R):5'- CAAAATGAAGCTGTGGACTTATCTCC -3'

Posted On

2016-11-09