Mutagenetix > Incidental Mutation

Incidental Mutation 'R5782:Fancd2'

447793

Institutional Source

Beutler Lab

Gene Symbol

Fancd2

Ensembl Gene

ENSMUSG00000034023

Gene Name

Fanconi anemia, complementation group D2

Synonyms

2410150O07Rik

MMRRC Submission

043379-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R5782 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

113531682-113597017 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 113548872 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 302 (N302S)

Ref Sequence

ENSEMBL: ENSMUSP00000144928 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000036340] [ENSMUST00000204827]

AlphaFold

Q80V62

Predicted Effect

probably benign
Transcript: ENSMUST00000036340
AA Change: N302S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000045667
Gene: ENSMUSG00000034023
AA Change: N302S

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1415	N/A	PFAM
low complexity region	1430	1450	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000123738

SMART Domains

Protein: ENSMUSP00000122091
Gene: ENSMUSG00000034023

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	246	5.7e-116	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142453

Predicted Effect

probably benign
Transcript: ENSMUST00000204827
AA Change: N302S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)

SMART Domains

Protein: ENSMUSP00000144928
Gene: ENSMUSG00000034023
AA Change: N302S

Domain	Start	End	E-Value	Type
Pfam:FancD2	1	1402	N/A	PFAM
low complexity region	1417	1437	N/A	INTRINSIC

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Fanconi anemia complementation group (FANC) currently includes FANCA, FANCB, FANCC, FANCD1 (also called BRCA2), FANCD2, FANCE, FANCF, FANCG, FANCI, FANCJ (also called BRIP1), FANCL, FANCM and FANCN (also called PALB2). The previously defined group FANCH is the same as FANCA. Fanconi anemia is a genetically heterogeneous recessive disorder characterized by cytogenetic instability, hypersensitivity to DNA crosslinking agents, increased chromosomal breakage, and defective DNA repair. The members of the Fanconi anemia complementation group do not share sequence similarity; they are related by their assembly into a common nuclear protein complex. This gene encodes the protein for complementation group D2. This protein is monoubiquinated in response to DNA damage, resulting in its localization to nuclear foci with other proteins (BRCA1 AND BRCA2) involved in homology-directed DNA repair. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutant mice exhibit defects observed in human patients with Fanconi anemia (FA) meiotic defects and germ cell loss. In addition, mutant mice display perinatal lethality, susceptiblity ot epithelial cancer, and microphthalmia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 68 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700021F05Rik	T	C	10: 43,532,903	I81M	probably benign	Het
2810403A07Rik	T	G	3: 88,711,678	V563G	probably damaging	Het
9130011E15Rik	A	G	19: 45,886,027	V569A	probably benign	Het
Actl9	A	T	17: 33,433,761	Q265L	probably benign	Het
Adamtsl3	T	A	7: 82,540,286		probably null	Het
Agt	A	T	8: 124,557,131		probably null	Het
Ankrd11	A	G	8: 122,900,017	L142P	probably damaging	Het
Arhgef19	C	A	4: 141,256,312	Q719K	probably damaging	Het
Atrnl1	G	T	19: 57,753,286	W1159L	possibly damaging	Het
Atxn2	T	C	5: 121,797,310	Y325H	probably damaging	Het
Brwd1	A	T	16: 96,043,043	Y770*	probably null	Het
Cdc20	T	C	4: 118,433,042	E474G	probably benign	Het
Cdk5rap3	A	G	11: 96,911,586	L254P	probably benign	Het
Cep83	A	T	10: 94,749,032	N333I	probably damaging	Het
Cox4i2	A	C	2: 152,764,811	D150A	probably damaging	Het
Cse1l	A	G	2: 166,929,001	I314M	probably damaging	Het
Cuedc1	A	G	11: 88,170,032	Y67C	probably damaging	Het
Cyp2j9	C	T	4: 96,573,905	V380I	probably benign	Het
D3Ertd254e	T	C	3: 36,164,979	S384P	possibly damaging	Het
Foxa1	T	A	12: 57,542,516	H306L	probably benign	Het
Gm21994	T	C	2: 150,255,518	E25G	probably benign	Het
Gse1	T	C	8: 120,566,521	S204P	probably damaging	Het
Hspa13	C	A	16: 75,758,097	R367L	probably damaging	Het
Kcnk2	T	G	1: 189,256,579	D267A	probably damaging	Het
Kctd18	A	G	1: 57,959,237	Y68H	probably damaging	Het
Klf7	C	T	1: 64,042,411	E253K	possibly damaging	Het
Lcn12	A	T	2: 25,493,757	F34I	probably damaging	Het
Lrrk2	A	T	15: 91,702,183	R401W	probably damaging	Het
Lzts1	A	T	8: 69,140,698	S86T	probably benign	Het
Mtus1	T	A	8: 41,082,727	I651F	probably damaging	Het
Myl2	T	A	5: 122,104,870	F106L	probably damaging	Het
Neb	T	A	2: 52,264,047	K2351*	probably null	Het
Olfr297	T	A	7: 86,527,213	I152N	probably damaging	Het
Olfr678	T	C	7: 105,069,749	I94T	probably damaging	Het
Otogl	G	A	10: 107,777,117		silent	Het
Parg	A	T	14: 32,274,905	R318*	probably null	Het
Pcdhga3	C	T	18: 37,676,300	S602F	possibly damaging	Het
Pcnx2	A	G	8: 125,753,484	V2028A	probably damaging	Het
Pkhd1	T	C	1: 20,058,600	T3960A	probably benign	Het
Psen1	T	A	12: 83,712,459	H81Q	possibly damaging	Het
Psma6	A	G	12: 55,410,256	N109S	possibly damaging	Het
Ptpro	A	T	6: 137,399,498	I659F	possibly damaging	Het
Rap1gds1	C	G	3: 138,959,079	E288D	possibly damaging	Het
Reln	C	T	5: 22,018,056	R993K	probably benign	Het
Saxo1	T	A	4: 86,445,807	L146F	probably damaging	Het
Six4	A	G	12: 73,104,058	V571A	probably benign	Het
Slc2a10	C	A	2: 165,514,838	Y139*	probably null	Het
Slc34a1	A	G	13: 55,402,688	I66V	possibly damaging	Het
Slfn8	G	T	11: 83,017,041	N46K	probably damaging	Het
Smc6	G	C	12: 11,290,834	A496P	probably damaging	Het
Stk31	T	G	6: 49,469,136	N902K	probably benign	Het
Stk36	T	A	1: 74,605,425	Y114N	possibly damaging	Het
Sult2b1	C	T	7: 45,731,346	V271M	probably damaging	Het
Tenm4	A	G	7: 96,893,039	I1920V	probably benign	Het
Trbc2	A	G	6: 41,546,937		probably benign	Het
Trpc2	A	G	7: 102,083,979	D419G	possibly damaging	Het
Trpm7	T	C	2: 126,797,714	N1654S	probably benign	Het
Tsku	A	T	7: 98,352,850	D91E	probably damaging	Het
Ttn	T	A	2: 76,776,011	R18151S	probably damaging	Het
Tyr	C	T	7: 87,493,016	C112Y	probably damaging	Het
Ubash3a	G	A	17: 31,235,503	G435S	probably benign	Het
Vav1	T	C	17: 57,296,001	I51T	probably damaging	Het
Vmn2r61	T	A	7: 42,299,829	C558S	probably damaging	Het
Zan	C	T	5: 137,420,007	C2943Y	unknown	Het
Zfp318	TGAAGAAGAAGAAGAAGAAGAAGAAGAAG	TGAAGAAGAAGAAGAAGAAGAAG	17: 46,412,514		probably benign	Het
Zfp575	C	A	7: 24,585,602	G205C	possibly damaging	Het
Zfp740	G	T	15: 102,208,366		probably benign	Het
Zzz3	A	G	3: 152,428,100	E265G	possibly damaging	Het

Other mutations in Fancd2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00401:Fancd2	APN	6	113564396	critical splice donor site	probably null
IGL00475:Fancd2	APN	6	113568610	missense	probably benign	0.01
IGL01319:Fancd2	APN	6	113584899	missense	probably damaging	0.98
IGL01339:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01373:Fancd2	APN	6	113553752	missense	probably benign	0.00
IGL01393:Fancd2	APN	6	113577360	splice site	probably benign
IGL01630:Fancd2	APN	6	113563124	missense	probably damaging	1.00
IGL01769:Fancd2	APN	6	113545111	missense	possibly damaging	0.90
IGL01882:Fancd2	APN	6	113546640	missense	probably benign	0.05
IGL02029:Fancd2	APN	6	113570975	missense	probably benign	0.44
IGL02224:Fancd2	APN	6	113568320	critical splice donor site	probably null
IGL02271:Fancd2	APN	6	113535759	splice site	probably benign
IGL02352:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02359:Fancd2	APN	6	113563112	missense	probably damaging	1.00
IGL02427:Fancd2	APN	6	113549352	splice site	probably null
IGL02512:Fancd2	APN	6	113570943	missense	probably damaging	1.00
IGL02530:Fancd2	APN	6	113562461	missense	probably damaging	1.00
IGL02801:Fancd2	APN	6	113593317	missense	probably benign	0.00
IGL03090:Fancd2	APN	6	113537597	splice site	probably null
IGL03247:Fancd2	APN	6	113568208	missense	probably benign	0.03
R0278:Fancd2	UTSW	6	113548448	critical splice donor site	probably null
R0401:Fancd2	UTSW	6	113548343	missense	possibly damaging	0.46
R0420:Fancd2	UTSW	6	113536979	missense	probably damaging	0.98
R0496:Fancd2	UTSW	6	113555130	splice site	probably benign
R0762:Fancd2	UTSW	6	113574658	missense	probably benign	0.20
R0827:Fancd2	UTSW	6	113586249	critical splice donor site	probably null
R1225:Fancd2	UTSW	6	113535861	missense	probably damaging	0.99
R1576:Fancd2	UTSW	6	113578405	missense	probably damaging	0.98
R2010:Fancd2	UTSW	6	113593291	missense	probably damaging	0.96
R2079:Fancd2	UTSW	6	113555187	missense	probably damaging	1.00
R2118:Fancd2	UTSW	6	113560074	splice site	probably benign
R2141:Fancd2	UTSW	6	113549321	missense	probably benign	0.00
R2168:Fancd2	UTSW	6	113591159	missense	possibly damaging	0.92
R2180:Fancd2	UTSW	6	113574637	missense	probably benign	0.33
R3016:Fancd2	UTSW	6	113536726	missense	probably benign	0.00
R3153:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3154:Fancd2	UTSW	6	113593269	missense	possibly damaging	0.55
R3783:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3786:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R3787:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R4379:Fancd2	UTSW	6	113561716	missense	probably benign	0.00
R4388:Fancd2	UTSW	6	113556368	missense	probably damaging	0.99
R4544:Fancd2	UTSW	6	113572642	critical splice acceptor site	probably null
R4598:Fancd2	UTSW	6	113585477	missense	probably benign	0.06
R4832:Fancd2	UTSW	6	113553722	missense	probably benign	0.16
R4841:Fancd2	UTSW	6	113562430	missense	probably damaging	1.00
R4922:Fancd2	UTSW	6	113585473	missense	probably benign	0.03
R5375:Fancd2	UTSW	6	113568712	missense	possibly damaging	0.93
R5579:Fancd2	UTSW	6	113560051	critical splice acceptor site	probably null
R5871:Fancd2	UTSW	6	113556282	missense	probably benign	0.30
R5901:Fancd2	UTSW	6	113549365	missense	probably damaging	1.00
R5909:Fancd2	UTSW	6	113561711	missense	probably benign
R6026:Fancd2	UTSW	6	113551770	missense	possibly damaging	0.46
R6166:Fancd2	UTSW	6	113555251	missense	possibly damaging	0.67
R6393:Fancd2	UTSW	6	113578413	missense	probably benign	0.01
R6666:Fancd2	UTSW	6	113585509	missense	probably damaging	0.96
R6669:Fancd2	UTSW	6	113593327	missense	probably benign	0.00
R6676:Fancd2	UTSW	6	113537665	nonsense	probably null
R6762:Fancd2	UTSW	6	113586016	splice site	probably null
R6911:Fancd2	UTSW	6	113548385	missense	probably damaging	0.98
R6992:Fancd2	UTSW	6	113571018	critical splice donor site	probably null
R7091:Fancd2	UTSW	6	113545101	missense	probably damaging	1.00
R7252:Fancd2	UTSW	6	113556285	missense	probably damaging	0.98
R7343:Fancd2	UTSW	6	113536939	missense	probably benign	0.01
R7344:Fancd2	UTSW	6	113568709	missense	probably benign	0.09
R7354:Fancd2	UTSW	6	113595946	missense	unknown
R7489:Fancd2	UTSW	6	113564304	missense	probably benign
R7501:Fancd2	UTSW	6	113548403	missense	possibly damaging	0.95
R7504:Fancd2	UTSW	6	113545038	missense	probably damaging	1.00
R7992:Fancd2	UTSW	6	113565204	missense	probably damaging	1.00
R8027:Fancd2	UTSW	6	113546622	missense	probably damaging	1.00
R8487:Fancd2	UTSW	6	113568226	missense	probably damaging	1.00
R8509:Fancd2	UTSW	6	113572570	missense	probably benign	0.00
R8757:Fancd2	UTSW	6	113560093	missense	possibly damaging	0.91
R8960:Fancd2	UTSW	6	113563168	critical splice donor site	probably null
R8978:Fancd2	UTSW	6	113585546	splice site	probably benign
R9110:Fancd2	UTSW	6	113535801	missense	possibly damaging	0.94
R9116:Fancd2	UTSW	6	113555219	missense	probably benign	0.00
R9490:Fancd2	UTSW	6	113578455	missense	probably damaging	0.98
R9667:Fancd2	UTSW	6	113553756	nonsense	probably null
Z1088:Fancd2	UTSW	6	113581422	missense	probably benign	0.00
Z1177:Fancd2	UTSW	6	113545025	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GGAACTCGAACTGTTCTCATCC -3'
(R):5'- AAATCCCTGTTGTGCTGTACG -3'

Sequencing Primer
(F):5'- TCATCCAGGCTGCTGACATG -3'
(R):5'- TGCTGTACGTGCACATAGC -3'

Posted On

2016-12-15