Incidental Mutation 'R5963:Gpr87'
ID471863
Institutional Source Beutler Lab
Gene Symbol Gpr87
Ensembl Gene ENSMUSG00000051431
Gene NameG protein-coupled receptor 87
Synonyms
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59178923-59195104 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 59179269 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 272 (R272*)
Ref Sequence ENSEMBL: ENSMUSP00000143683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040325] [ENSMUST00000056898] [ENSMUST00000164225] [ENSMUST00000199659] [ENSMUST00000200095]
Predicted Effect probably benign
Transcript: ENSMUST00000040325
SMART Domains Protein: ENSMUSP00000042269
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 730 2.6e-207 PFAM
low complexity region 744 758 N/A INTRINSIC
low complexity region 853 872 N/A INTRINSIC
low complexity region 1455 1466 N/A INTRINSIC
low complexity region 1728 1742 N/A INTRINSIC
low complexity region 1769 1783 N/A INTRINSIC
Pfam:Med12-PQL 1803 2029 2.3e-14 PFAM
low complexity region 2055 2076 N/A INTRINSIC
low complexity region 2083 2101 N/A INTRINSIC
low complexity region 2116 2136 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000056898
AA Change: R273*
SMART Domains Protein: ENSMUSP00000059272
Gene: ENSMUSG00000051431
AA Change: R273*

DomainStartEndE-ValueType
Pfam:7tm_1 60 315 1.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164225
SMART Domains Protein: ENSMUSP00000127038
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 283 765 5e-187 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1763 1777 N/A INTRINSIC
low complexity region 1804 1818 N/A INTRINSIC
Pfam:Med12-PQL 1840 2063 9.7e-66 PFAM
low complexity region 2090 2111 N/A INTRINSIC
low complexity region 2118 2136 N/A INTRINSIC
low complexity region 2151 2171 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000199659
SMART Domains Protein: ENSMUSP00000142903
Gene: ENSMUSG00000056476

DomainStartEndE-ValueType
Med12 101 161 1.71e-24 SMART
low complexity region 216 224 N/A INTRINSIC
low complexity region 269 278 N/A INTRINSIC
Pfam:Med12-LCEWAV 282 765 5.5e-209 PFAM
low complexity region 779 793 N/A INTRINSIC
low complexity region 888 907 N/A INTRINSIC
low complexity region 1490 1501 N/A INTRINSIC
low complexity region 1761 1775 N/A INTRINSIC
low complexity region 1802 1816 N/A INTRINSIC
Pfam:Med12-PQL 1836 2062 1.7e-15 PFAM
low complexity region 2088 2130 N/A INTRINSIC
low complexity region 2144 2164 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199833
Predicted Effect probably null
Transcript: ENSMUST00000200095
AA Change: R272*
SMART Domains Protein: ENSMUSP00000143683
Gene: ENSMUSG00000051431
AA Change: R272*

DomainStartEndE-ValueType
Pfam:7tm_1 59 314 3.5e-37 PFAM
Meta Mutation Damage Score 0.9718 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor and is located in a cluster of G protein-couple receptor genes on chromosome 3. The encoded protein has been shown to be overexpressed in lung squamous cell carcinoma (PMID:18057535) and regulated by p53 (PMID:19602589). [provided by RefSeq, Nov 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased mean vertebral and femoral bone measurements. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Gpr87
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Gpr87 APN 3 59179790 missense probably damaging 1.00
IGL02309:Gpr87 APN 3 59179554 missense possibly damaging 0.74
IGL02614:Gpr87 APN 3 59179317 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0097:Gpr87 UTSW 3 59179085 missense probably damaging 1.00
R0113:Gpr87 UTSW 3 59179511 missense possibly damaging 0.86
R1801:Gpr87 UTSW 3 59179392 missense possibly damaging 0.92
R2213:Gpr87 UTSW 3 59179044 missense probably damaging 0.99
R2698:Gpr87 UTSW 3 59179166 missense probably damaging 1.00
R5459:Gpr87 UTSW 3 59179727 missense possibly damaging 0.89
R5490:Gpr87 UTSW 3 59179326 missense probably damaging 0.99
R6189:Gpr87 UTSW 3 59179229 missense probably damaging 1.00
R6251:Gpr87 UTSW 3 59179107 missense probably damaging 0.99
R7863:Gpr87 UTSW 3 59179896 missense probably damaging 1.00
R8008:Gpr87 UTSW 3 59180045 missense probably benign
R8065:Gpr87 UTSW 3 59179887 missense probably damaging 1.00
R8067:Gpr87 UTSW 3 59179887 missense probably damaging 1.00
R8096:Gpr87 UTSW 3 59179808 missense possibly damaging 0.70
R8141:Gpr87 UTSW 3 59179599 missense probably damaging 1.00
R8326:Gpr87 UTSW 3 59194974 start gained probably benign
Z1177:Gpr87 UTSW 3 59180070 missense probably benign
Predicted Primers PCR Primer
(F):5'- GATCTTCGGACGCTTTGCAG -3'
(R):5'- TGTCACCTATGTGGACAGCTG -3'

Sequencing Primer
(F):5'- AGCGACCTGATGCTTTCG -3'
(R):5'- CACCTATGTGGACAGCTGTTTGTTTG -3'
Posted On2017-03-31