Incidental Mutation 'R5963:Vps8'
ID471901
Institutional Source Beutler Lab
Gene Symbol Vps8
Ensembl Gene ENSMUSG00000033653
Gene NameVPS8 CORVET complex subunit
Synonyms
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5963 (G1)
Quality Score181
Status Validated
Chromosome16
Chromosomal Location21423118-21644680 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21470121 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 408 (I408T)
Ref Sequence ENSEMBL: ENSMUSP00000112937 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096191
AA Change: I408T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: I408T

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 7e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.7e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
Blast:RING 1257 1277 1e-5 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000096192
AA Change: I410T

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: I410T

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 1e-8 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.4e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115397
AA Change: I410T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: I410T

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 8e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 613 796 1.3e-61 PFAM
low complexity region 994 1009 N/A INTRINSIC
low complexity region 1087 1099 N/A INTRINSIC
low complexity region 1128 1139 N/A INTRINSIC
RING 1259 1310 1.23e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000117598
AA Change: I408T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: I408T

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 296 1e-8 SMART
Blast:WD40 184 225 8e-22 BLAST
Blast:WD40 228 268 5e-20 BLAST
Pfam:Vps8 610 794 1.9e-61 PFAM
low complexity region 992 1007 N/A INTRINSIC
low complexity region 1085 1097 N/A INTRINSIC
low complexity region 1126 1137 N/A INTRINSIC
RING 1257 1308 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000118923
AA Change: I410T

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: I410T

DomainStartEndE-ValueType
low complexity region 96 112 N/A INTRINSIC
SCOP:d1g72a_ 158 298 9e-9 SMART
Blast:WD40 186 227 8e-22 BLAST
Blast:WD40 230 270 5e-20 BLAST
Pfam:Vps8 612 796 1.9e-61 PFAM
low complexity region 969 979 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1098 1109 N/A INTRINSIC
RING 1229 1280 1.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125487
SMART Domains Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

DomainStartEndE-ValueType
Pfam:Vps8 182 365 8.5e-62 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 656 668 N/A INTRINSIC
low complexity region 697 708 N/A INTRINSIC
RING 828 879 1.23e-4 SMART
Meta Mutation Damage Score 0.2941 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Ccdc138 A G 10: 58,575,757 H649R possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Vps8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Vps8 APN 16 21442334 missense possibly damaging 0.47
IGL00596:Vps8 APN 16 21448412 splice site probably benign
IGL00985:Vps8 APN 16 21477584 splice site probably benign
IGL01356:Vps8 APN 16 21517357 critical splice donor site probably null
IGL01375:Vps8 APN 16 21559372 nonsense probably null
IGL01643:Vps8 APN 16 21518222 missense possibly damaging 0.92
IGL02159:Vps8 APN 16 21466484 missense possibly damaging 0.69
IGL02214:Vps8 APN 16 21517285 missense probably damaging 1.00
IGL02465:Vps8 APN 16 21521903 missense probably damaging 1.00
IGL02651:Vps8 APN 16 21517336 missense probably damaging 0.99
IGL03174:Vps8 APN 16 21466463 missense probably damaging 1.00
IGL03337:Vps8 APN 16 21563168 missense probably benign
IGL03383:Vps8 APN 16 21435823 critical splice donor site probably null
IGL03402:Vps8 APN 16 21448398 missense possibly damaging 0.68
empires UTSW 16 21581548 nonsense probably null
porky UTSW 16 21461238 missense probably benign 0.32
realm UTSW 16 21545236 intron probably benign
realms UTSW 16 21444188 splice site probably null
Reich UTSW 16 21478439 missense probably benign 0.29
reichen UTSW 16 21506825 splice site probably benign
IGL03052:Vps8 UTSW 16 21448365 missense probably damaging 0.99
PIT4677001:Vps8 UTSW 16 21500334 missense possibly damaging 0.94
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0066:Vps8 UTSW 16 21477523 missense possibly damaging 0.77
R0125:Vps8 UTSW 16 21470154 missense probably benign 0.00
R0137:Vps8 UTSW 16 21504386 splice site probably benign
R0362:Vps8 UTSW 16 21608227 intron probably benign
R0384:Vps8 UTSW 16 21506825 splice site probably benign
R0492:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0525:Vps8 UTSW 16 21540109 critical splice donor site probably null
R0531:Vps8 UTSW 16 21459811 intron probably benign
R0605:Vps8 UTSW 16 21559337 missense probably benign 0.00
R0636:Vps8 UTSW 16 21434933 missense probably benign 0.32
R0707:Vps8 UTSW 16 21442357 missense probably damaging 1.00
R0840:Vps8 UTSW 16 21456321 missense probably damaging 0.99
R1170:Vps8 UTSW 16 21459820 intron probably benign
R1203:Vps8 UTSW 16 21511557 missense probably damaging 1.00
R1482:Vps8 UTSW 16 21581598 missense probably benign 0.00
R1531:Vps8 UTSW 16 21466476 nonsense probably null
R1642:Vps8 UTSW 16 21581579 missense probably benign
R1956:Vps8 UTSW 16 21461142 missense probably damaging 1.00
R2201:Vps8 UTSW 16 21576757 missense probably damaging 1.00
R2287:Vps8 UTSW 16 21568413 missense probably damaging 1.00
R2423:Vps8 UTSW 16 21559337 missense probably benign 0.00
R3151:Vps8 UTSW 16 21442373 missense probably benign 0.04
R3943:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R3944:Vps8 UTSW 16 21470123 missense probably damaging 1.00
R4043:Vps8 UTSW 16 21526396 missense probably damaging 1.00
R4302:Vps8 UTSW 16 21495914 missense probably damaging 1.00
R4398:Vps8 UTSW 16 21504466 missense probably damaging 1.00
R4477:Vps8 UTSW 16 21545236 intron probably benign
R4478:Vps8 UTSW 16 21545236 intron probably benign
R4479:Vps8 UTSW 16 21545236 intron probably benign
R4480:Vps8 UTSW 16 21545236 intron probably benign
R4571:Vps8 UTSW 16 21435775 missense probably damaging 1.00
R4653:Vps8 UTSW 16 21500210 missense probably damaging 1.00
R4664:Vps8 UTSW 16 21444188 splice site probably null
R4713:Vps8 UTSW 16 21442439 missense probably damaging 1.00
R4726:Vps8 UTSW 16 21448404 splice site probably null
R4959:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4973:Vps8 UTSW 16 21459786 missense probably damaging 1.00
R4975:Vps8 UTSW 16 21466469 missense probably damaging 1.00
R4992:Vps8 UTSW 16 21461408 missense possibly damaging 0.52
R5144:Vps8 UTSW 16 21559353 missense probably damaging 1.00
R5168:Vps8 UTSW 16 21457445 missense probably damaging 0.99
R5168:Vps8 UTSW 16 21533099 missense probably benign 0.05
R5222:Vps8 UTSW 16 21581548 nonsense probably null
R5231:Vps8 UTSW 16 21576725 missense probably damaging 1.00
R5876:Vps8 UTSW 16 21461439 critical splice donor site probably null
R6010:Vps8 UTSW 16 21545205 intron probably benign
R6023:Vps8 UTSW 16 21461238 missense probably benign 0.32
R6173:Vps8 UTSW 16 21495932 splice site probably null
R6185:Vps8 UTSW 16 21470141 missense probably damaging 0.98
R6264:Vps8 UTSW 16 21559349 nonsense probably null
R6409:Vps8 UTSW 16 21478439 missense probably benign 0.29
R6522:Vps8 UTSW 16 21442379 missense probably damaging 0.99
R6528:Vps8 UTSW 16 21554125 nonsense probably null
R6784:Vps8 UTSW 16 21563207 missense probably benign 0.01
R7040:Vps8 UTSW 16 21575022 missense probably damaging 1.00
R7072:Vps8 UTSW 16 21581579 missense probably benign
R7103:Vps8 UTSW 16 21526441 missense probably damaging 1.00
R7149:Vps8 UTSW 16 21459776 missense probably damaging 1.00
R7195:Vps8 UTSW 16 21456282 missense probably damaging 1.00
R7206:Vps8 UTSW 16 21457421 missense probably damaging 1.00
R7403:Vps8 UTSW 16 21434972 missense possibly damaging 0.78
R7782:Vps8 UTSW 16 21511558 missense possibly damaging 0.89
R7806:Vps8 UTSW 16 21459751 missense probably damaging 1.00
R7846:Vps8 UTSW 16 21532320 missense probably benign 0.01
R7943:Vps8 UTSW 16 21477872 missense possibly damaging 0.66
R8075:Vps8 UTSW 16 21521894 missense probably damaging 0.99
R8190:Vps8 UTSW 16 21575030 missense possibly damaging 0.73
R8307:Vps8 UTSW 16 21495902 missense probably benign 0.02
R8483:Vps8 UTSW 16 21575013 missense probably damaging 0.98
R8814:Vps8 UTSW 16 21576650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTCCCTTATGCAAGCAG -3'
(R):5'- ACTGTGGGGAGATCAATGC -3'

Sequencing Primer
(F):5'- CCTTATGCAAGCAGAGTGTCATCTG -3'
(R):5'- GGTGTGGTGGCACTCAC -3'
Posted On2017-03-31