Mutagenetix > Incidental Mutations

Incidental Mutation 'R5963:Vps8'

471901

Institutional Source

Beutler Lab

Gene Symbol

Vps8

Ensembl Gene

ENSMUSG00000033653

Gene Name

VPS8 CORVET complex subunit

Synonyms

MMRRC Submission

044148-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R5963 (G1)

Quality Score

181

Status

Validated

Chromosome

Chromosomal Location

21423118-21644680 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 21470121 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 408 (I408T)

Ref Sequence

ENSEMBL: ENSMUSP00000112937 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000096191] [ENSMUST00000096192] [ENSMUST00000115397] [ENSMUST00000117598] [ENSMUST00000118923]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000096191
AA Change: I408T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000093905
Gene: ENSMUSG00000033653
AA Change: I408T

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	7e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.7e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
Blast:RING	1257	1277	1e-5	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000096192
AA Change: I410T

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000093906
Gene: ENSMUSG00000033653
AA Change: I410T

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	1e-8	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.4e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000115397
AA Change: I410T

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000111055
Gene: ENSMUSG00000033653
AA Change: I410T

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	8e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	613	796	1.3e-61	PFAM
low complexity region	994	1009	N/A	INTRINSIC
low complexity region	1087	1099	N/A	INTRINSIC
low complexity region	1128	1139	N/A	INTRINSIC
RING	1259	1310	1.23e-4	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000117598
AA Change: I408T

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000112937
Gene: ENSMUSG00000033653
AA Change: I408T

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	296	1e-8	SMART
Blast:WD40	184	225	8e-22	BLAST
Blast:WD40	228	268	5e-20	BLAST
Pfam:Vps8	610	794	1.9e-61	PFAM
low complexity region	992	1007	N/A	INTRINSIC
low complexity region	1085	1097	N/A	INTRINSIC
low complexity region	1126	1137	N/A	INTRINSIC
RING	1257	1308	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000118923
AA Change: I410T

PolyPhen 2 Score 0.107 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000112636
Gene: ENSMUSG00000033653
AA Change: I410T

Domain	Start	End	E-Value	Type
low complexity region	96	112	N/A	INTRINSIC
SCOP:d1g72a_	158	298	9e-9	SMART
Blast:WD40	186	227	8e-22	BLAST
Blast:WD40	230	270	5e-20	BLAST
Pfam:Vps8	612	796	1.9e-61	PFAM
low complexity region	969	979	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1098	1109	N/A	INTRINSIC
RING	1229	1280	1.23e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125487

SMART Domains

Protein: ENSMUSP00000114719
Gene: ENSMUSG00000033653

Domain	Start	End	E-Value	Type
Pfam:Vps8	182	365	8.5e-62	PFAM
low complexity region	563	578	N/A	INTRINSIC
low complexity region	656	668	N/A	INTRINSIC
low complexity region	697	708	N/A	INTRINSIC
RING	828	879	1.23e-4	SMART

Meta Mutation Damage Score

0.2941

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.7%
20x: 92.5%

Validation Efficiency

99% (68/69)

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Alg8	A	G	7: 97,379,830	K131E	probably benign	Het
Ank3	T	A	10: 69,987,226	L575*	probably null	Het
Aqr	T	C	2: 114,126,961	T819A	probably damaging	Het
Bbs2	A	T	8: 94,081,031	S407T	probably benign	Het
Bmper	T	A	9: 23,375,593	C272S	probably benign	Het
Btbd9	C	T	17: 30,334,218		probably null	Het
C5ar1	A	G	7: 16,248,822	V91A	possibly damaging	Het
Ccdc138	A	G	10: 58,575,757	H649R	possibly damaging	Het
Cfap43	A	T	19: 47,745,574	V1451E	probably benign	Het
Cfap46	T	A	7: 139,651,595	M901L	probably damaging	Het
Cherp	G	T	8: 72,461,535		probably benign	Het
D430041D05Rik	C	T	2: 104,248,285	V1229I	possibly damaging	Het
Fat4	A	C	3: 39,010,547	D4884A	probably damaging	Het
Fcrl5	T	C	3: 87,444,173	F243L	probably damaging	Het
Garem1	T	A	18: 21,129,430	I776F	probably benign	Het
Gpr87	T	A	3: 59,179,269	R272*	probably null	Het
Gsdmc	A	T	15: 63,780,116		probably null	Het
Hydin	T	A	8: 110,494,294	F1441I	possibly damaging	Het
Ints11	T	A	4: 155,872,912	C63*	probably null	Het
Kdm4b	A	T	17: 56,399,732	T908S	probably damaging	Het
Lipn	A	G	19: 34,081,300	D304G	probably damaging	Het
Man2a1	T	G	17: 64,675,122	N544K	probably benign	Het
Mapkapk5	G	T	5: 121,538,481	H66N	probably damaging	Het
Mog	G	A	17: 37,012,348	R233*	probably null	Het
Mrps24	A	T	11: 5,707,481		probably benign	Het
Nom1	T	C	5: 29,437,770	L423P	probably damaging	Het
Olfr65	T	A	7: 103,906,961	V174E	probably benign	Het
Pcdha1	T	A	18: 36,931,171	V296E	probably damaging	Het
Pdcd2	T	C	17: 15,526,394	K168E	possibly damaging	Het
Pdcd2	G	T	17: 15,526,395	H167Q	probably damaging	Het
Pla2g12b	T	A	10: 59,403,958	V63D	probably damaging	Het
Pnn	C	T	12: 59,067,831	R56*	probably null	Het
Primpol	T	A	8: 46,593,580	E227V	possibly damaging	Het
Rad54l	A	T	4: 116,110,387	W233R	probably damaging	Het
Rims2	A	T	15: 39,437,182	D103V	probably damaging	Het
Rttn	T	C	18: 89,073,695	S1511P	probably benign	Het
Sept5	T	C	16: 18,624,212		probably null	Het
Simc1	T	A	13: 54,525,819	I660K	possibly damaging	Het
Slc15a5	A	G	6: 138,079,693	L75P	probably damaging	Het
Slc9a2	A	G	1: 40,682,036	S55G	possibly damaging	Het
Slit3	C	T	11: 35,700,236	R1292C	probably damaging	Het
Slitrk3	A	G	3: 73,050,713	V242A	probably benign	Het
St14	A	T	9: 31,106,557		probably benign	Het
Tnnt2	T	C	1: 135,843,862		probably benign	Het
Traf5	G	A	1: 192,000,016	T288I	probably benign	Het
Trerf1	C	T	17: 47,314,337		noncoding transcript	Het
Vegfc	A	G	8: 54,181,284	N333D	probably benign	Het
Vmn1r65	T	A	7: 6,008,609	I209F	probably damaging	Het
Vps51	A	G	19: 6,068,290	L725P	probably damaging	Het
Wdr72	T	C	9: 74,145,028	Y114H	probably damaging	Het
Ybx2	A	G	11: 69,941,092	E164G	probably damaging	Het
Zcchc14	A	T	8: 121,628,623		probably benign	Het
Zfp383	A	G	7: 29,915,678	T453A	possibly damaging	Het
Zfp84	G	T	7: 29,776,953	G357C	probably damaging	Het
Zmynd11	G	T	13: 9,695,895		probably benign	Het

Other mutations in Vps8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00500:Vps8	APN	16	21442334	missense	possibly damaging	0.47
IGL00596:Vps8	APN	16	21448412	splice site	probably benign
IGL00985:Vps8	APN	16	21477584	splice site	probably benign
IGL01356:Vps8	APN	16	21517357	critical splice donor site	probably null
IGL01375:Vps8	APN	16	21559372	nonsense	probably null
IGL01643:Vps8	APN	16	21518222	missense	possibly damaging	0.92
IGL02159:Vps8	APN	16	21466484	missense	possibly damaging	0.69
IGL02214:Vps8	APN	16	21517285	missense	probably damaging	1.00
IGL02465:Vps8	APN	16	21521903	missense	probably damaging	1.00
IGL02651:Vps8	APN	16	21517336	missense	probably damaging	0.99
IGL03174:Vps8	APN	16	21466463	missense	probably damaging	1.00
IGL03337:Vps8	APN	16	21563168	missense	probably benign
IGL03383:Vps8	APN	16	21435823	critical splice donor site	probably null
IGL03402:Vps8	APN	16	21448398	missense	possibly damaging	0.68
empires	UTSW	16	21581548	nonsense	probably null
porky	UTSW	16	21461238	missense	probably benign	0.32
realm	UTSW	16	21545236	intron	probably benign
realms	UTSW	16	21444188	splice site	probably null
Reich	UTSW	16	21478439	missense	probably benign	0.29
reichen	UTSW	16	21506825	splice site	probably benign
IGL03052:Vps8	UTSW	16	21448365	missense	probably damaging	0.99
PIT4677001:Vps8	UTSW	16	21500334	missense	possibly damaging	0.94
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0066:Vps8	UTSW	16	21477523	missense	possibly damaging	0.77
R0125:Vps8	UTSW	16	21470154	missense	probably benign	0.00
R0137:Vps8	UTSW	16	21504386	splice site	probably benign
R0362:Vps8	UTSW	16	21608227	intron	probably benign
R0384:Vps8	UTSW	16	21506825	splice site	probably benign
R0492:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0525:Vps8	UTSW	16	21540109	critical splice donor site	probably null
R0531:Vps8	UTSW	16	21459811	intron	probably benign
R0605:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R0636:Vps8	UTSW	16	21434933	missense	probably benign	0.32
R0707:Vps8	UTSW	16	21442357	missense	probably damaging	1.00
R0840:Vps8	UTSW	16	21456321	missense	probably damaging	0.99
R1170:Vps8	UTSW	16	21459820	intron	probably benign
R1203:Vps8	UTSW	16	21511557	missense	probably damaging	1.00
R1482:Vps8	UTSW	16	21581598	missense	probably benign	0.00
R1531:Vps8	UTSW	16	21466476	nonsense	probably null
R1642:Vps8	UTSW	16	21581579	missense	probably benign
R1956:Vps8	UTSW	16	21461142	missense	probably damaging	1.00
R2201:Vps8	UTSW	16	21576757	missense	probably damaging	1.00
R2287:Vps8	UTSW	16	21568413	missense	probably damaging	1.00
R2423:Vps8	UTSW	16	21559337	missense	probably benign	0.00
R3151:Vps8	UTSW	16	21442373	missense	probably benign	0.04
R3943:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R3944:Vps8	UTSW	16	21470123	missense	probably damaging	1.00
R4043:Vps8	UTSW	16	21526396	missense	probably damaging	1.00
R4302:Vps8	UTSW	16	21495914	missense	probably damaging	1.00
R4398:Vps8	UTSW	16	21504466	missense	probably damaging	1.00
R4477:Vps8	UTSW	16	21545236	intron	probably benign
R4478:Vps8	UTSW	16	21545236	intron	probably benign
R4479:Vps8	UTSW	16	21545236	intron	probably benign
R4480:Vps8	UTSW	16	21545236	intron	probably benign
R4571:Vps8	UTSW	16	21435775	missense	probably damaging	1.00
R4653:Vps8	UTSW	16	21500210	missense	probably damaging	1.00
R4664:Vps8	UTSW	16	21444188	splice site	probably null
R4713:Vps8	UTSW	16	21442439	missense	probably damaging	1.00
R4726:Vps8	UTSW	16	21448404	splice site	probably null
R4959:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4973:Vps8	UTSW	16	21459786	missense	probably damaging	1.00
R4975:Vps8	UTSW	16	21466469	missense	probably damaging	1.00
R4992:Vps8	UTSW	16	21461408	missense	possibly damaging	0.52
R5144:Vps8	UTSW	16	21559353	missense	probably damaging	1.00
R5168:Vps8	UTSW	16	21457445	missense	probably damaging	0.99
R5168:Vps8	UTSW	16	21533099	missense	probably benign	0.05
R5222:Vps8	UTSW	16	21581548	nonsense	probably null
R5231:Vps8	UTSW	16	21576725	missense	probably damaging	1.00
R5876:Vps8	UTSW	16	21461439	critical splice donor site	probably null
R6010:Vps8	UTSW	16	21545205	intron	probably benign
R6023:Vps8	UTSW	16	21461238	missense	probably benign	0.32
R6173:Vps8	UTSW	16	21495932	splice site	probably null
R6185:Vps8	UTSW	16	21470141	missense	probably damaging	0.98
R6264:Vps8	UTSW	16	21559349	nonsense	probably null
R6409:Vps8	UTSW	16	21478439	missense	probably benign	0.29
R6522:Vps8	UTSW	16	21442379	missense	probably damaging	0.99
R6528:Vps8	UTSW	16	21554125	nonsense	probably null
R6784:Vps8	UTSW	16	21563207	missense	probably benign	0.01
R7040:Vps8	UTSW	16	21575022	missense	probably damaging	1.00
R7072:Vps8	UTSW	16	21581579	missense	probably benign
R7103:Vps8	UTSW	16	21526441	missense	probably damaging	1.00
R7149:Vps8	UTSW	16	21459776	missense	probably damaging	1.00
R7195:Vps8	UTSW	16	21456282	missense	probably damaging	1.00
R7206:Vps8	UTSW	16	21457421	missense	probably damaging	1.00
R7403:Vps8	UTSW	16	21434972	missense	possibly damaging	0.78
R7782:Vps8	UTSW	16	21511558	missense	possibly damaging	0.89
R7806:Vps8	UTSW	16	21459751	missense	probably damaging	1.00
R7846:Vps8	UTSW	16	21532320	missense	probably benign	0.01
R7943:Vps8	UTSW	16	21477872	missense	possibly damaging	0.66
R8075:Vps8	UTSW	16	21521894	missense	probably damaging	0.99
R8190:Vps8	UTSW	16	21575030	missense	possibly damaging	0.73
R8307:Vps8	UTSW	16	21495902	missense	probably benign	0.02
R8483:Vps8	UTSW	16	21575013	missense	probably damaging	0.98
R8814:Vps8	UTSW	16	21576650	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCTTCCCTTATGCAAGCAG -3'
(R):5'- ACTGTGGGGAGATCAATGC -3'

Sequencing Primer
(F):5'- CCTTATGCAAGCAGAGTGTCATCTG -3'
(R):5'- GGTGTGGTGGCACTCAC -3'

Posted On

2017-03-31