Incidental Mutation 'R5963:Ccdc138'
ID471886
Institutional Source Beutler Lab
Gene Symbol Ccdc138
Ensembl Gene ENSMUSG00000038010
Gene Namecoiled-coil domain containing 138
Synonyms6230424H07Rik
MMRRC Submission 044148-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock #R5963 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location58497948-58576244 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 58575757 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 649 (H649R)
Ref Sequence ENSEMBL: ENSMUSP00000043040 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036576]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036576
AA Change: H649R

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043040
Gene: ENSMUSG00000038010
AA Change: H649R

DomainStartEndE-ValueType
coiled coil region 259 339 N/A INTRINSIC
low complexity region 355 365 N/A INTRINSIC
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.5%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg8 A G 7: 97,379,830 K131E probably benign Het
Ank3 T A 10: 69,987,226 L575* probably null Het
Aqr T C 2: 114,126,961 T819A probably damaging Het
Bbs2 A T 8: 94,081,031 S407T probably benign Het
Bmper T A 9: 23,375,593 C272S probably benign Het
Btbd9 C T 17: 30,334,218 probably null Het
C5ar1 A G 7: 16,248,822 V91A possibly damaging Het
Cfap43 A T 19: 47,745,574 V1451E probably benign Het
Cfap46 T A 7: 139,651,595 M901L probably damaging Het
Cherp G T 8: 72,461,535 probably benign Het
D430041D05Rik C T 2: 104,248,285 V1229I possibly damaging Het
Fat4 A C 3: 39,010,547 D4884A probably damaging Het
Fcrl5 T C 3: 87,444,173 F243L probably damaging Het
Garem1 T A 18: 21,129,430 I776F probably benign Het
Gpr87 T A 3: 59,179,269 R272* probably null Het
Gsdmc A T 15: 63,780,116 probably null Het
Hydin T A 8: 110,494,294 F1441I possibly damaging Het
Ints11 T A 4: 155,872,912 C63* probably null Het
Kdm4b A T 17: 56,399,732 T908S probably damaging Het
Lipn A G 19: 34,081,300 D304G probably damaging Het
Man2a1 T G 17: 64,675,122 N544K probably benign Het
Mapkapk5 G T 5: 121,538,481 H66N probably damaging Het
Mog G A 17: 37,012,348 R233* probably null Het
Mrps24 A T 11: 5,707,481 probably benign Het
Nom1 T C 5: 29,437,770 L423P probably damaging Het
Olfr65 T A 7: 103,906,961 V174E probably benign Het
Pcdha1 T A 18: 36,931,171 V296E probably damaging Het
Pdcd2 T C 17: 15,526,394 K168E possibly damaging Het
Pdcd2 G T 17: 15,526,395 H167Q probably damaging Het
Pla2g12b T A 10: 59,403,958 V63D probably damaging Het
Pnn C T 12: 59,067,831 R56* probably null Het
Primpol T A 8: 46,593,580 E227V possibly damaging Het
Rad54l A T 4: 116,110,387 W233R probably damaging Het
Rims2 A T 15: 39,437,182 D103V probably damaging Het
Rttn T C 18: 89,073,695 S1511P probably benign Het
Sept5 T C 16: 18,624,212 probably null Het
Simc1 T A 13: 54,525,819 I660K possibly damaging Het
Slc15a5 A G 6: 138,079,693 L75P probably damaging Het
Slc9a2 A G 1: 40,682,036 S55G possibly damaging Het
Slit3 C T 11: 35,700,236 R1292C probably damaging Het
Slitrk3 A G 3: 73,050,713 V242A probably benign Het
St14 A T 9: 31,106,557 probably benign Het
Tnnt2 T C 1: 135,843,862 probably benign Het
Traf5 G A 1: 192,000,016 T288I probably benign Het
Trerf1 C T 17: 47,314,337 noncoding transcript Het
Vegfc A G 8: 54,181,284 N333D probably benign Het
Vmn1r65 T A 7: 6,008,609 I209F probably damaging Het
Vps51 A G 19: 6,068,290 L725P probably damaging Het
Vps8 T C 16: 21,470,121 I408T possibly damaging Het
Wdr72 T C 9: 74,145,028 Y114H probably damaging Het
Ybx2 A G 11: 69,941,092 E164G probably damaging Het
Zcchc14 A T 8: 121,628,623 probably benign Het
Zfp383 A G 7: 29,915,678 T453A possibly damaging Het
Zfp84 G T 7: 29,776,953 G357C probably damaging Het
Zmynd11 G T 13: 9,695,895 probably benign Het
Other mutations in Ccdc138
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Ccdc138 APN 10 58575715 missense probably damaging 1.00
IGL00957:Ccdc138 APN 10 58529016 splice site probably benign
IGL01012:Ccdc138 APN 10 58540915 critical splice donor site probably null
IGL01725:Ccdc138 APN 10 58528923 missense possibly damaging 0.50
IGL01996:Ccdc138 APN 10 58562030 missense probably damaging 1.00
IGL02083:Ccdc138 APN 10 58544914 splice site probably benign
IGL02652:Ccdc138 APN 10 58513079 missense probably benign 0.00
IGL02820:Ccdc138 APN 10 58528899 splice site probably benign
IGL02934:Ccdc138 APN 10 58573580 splice site probably benign
IGL03231:Ccdc138 APN 10 58573706 missense probably damaging 1.00
R0128:Ccdc138 UTSW 10 58528360 missense probably damaging 1.00
R0271:Ccdc138 UTSW 10 58575823 missense probably damaging 0.99
R0480:Ccdc138 UTSW 10 58561967 missense probably damaging 1.00
R0560:Ccdc138 UTSW 10 58575717 missense probably damaging 1.00
R0645:Ccdc138 UTSW 10 58575720 missense probably damaging 1.00
R1405:Ccdc138 UTSW 10 58545117 splice site probably benign
R2032:Ccdc138 UTSW 10 58513162 missense possibly damaging 0.71
R2097:Ccdc138 UTSW 10 58561937 nonsense probably null
R2350:Ccdc138 UTSW 10 58561893 splice site probably benign
R2571:Ccdc138 UTSW 10 58513222 missense probably benign 0.25
R3787:Ccdc138 UTSW 10 58538270 missense probably damaging 1.00
R3805:Ccdc138 UTSW 10 58561997 missense possibly damaging 0.95
R4582:Ccdc138 UTSW 10 58507643 critical splice donor site probably null
R4630:Ccdc138 UTSW 10 58573655 missense probably damaging 1.00
R4801:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4802:Ccdc138 UTSW 10 58573643 missense probably damaging 1.00
R4883:Ccdc138 UTSW 10 58561996 missense probably benign 0.03
R4908:Ccdc138 UTSW 10 58544995 missense possibly damaging 0.84
R5032:Ccdc138 UTSW 10 58573636 missense probably damaging 1.00
R5155:Ccdc138 UTSW 10 58507572 missense probably benign 0.00
R5287:Ccdc138 UTSW 10 58575705 missense possibly damaging 0.89
R5683:Ccdc138 UTSW 10 58540819 missense probably damaging 1.00
R6530:Ccdc138 UTSW 10 58544968 missense probably damaging 1.00
R7148:Ccdc138 UTSW 10 58538280 missense probably damaging 1.00
R7217:Ccdc138 UTSW 10 58509600 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- AGTATCTTAATCCTGTAGTCAGCC -3'
(R):5'- ACAGCCATACCTTCTACGGG -3'

Sequencing Primer
(F):5'- GTAGTCAGCCATTTTCTCCATTG -3'
(R):5'- ACGGGTCTCATTTACGTTGC -3'
Posted On2017-03-31