Incidental Mutation 'R0506:Cdk8'
ID 47575
Institutional Source Beutler Lab
Gene Symbol Cdk8
Ensembl Gene ENSMUSG00000029635
Gene Name cyclin-dependent kinase 8
Synonyms
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R0506 (G1)
Quality Score 200
Status Validated
Chromosome 5
Chromosomal Location 146231230-146302874 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 146298872 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 270 (F270L)
Ref Sequence ENSEMBL: ENSMUSP00000125668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031640] [ENSMUST00000161181] [ENSMUST00000162494]
AlphaFold Q8R3L8
Predicted Effect probably damaging
Transcript: ENSMUST00000031640
AA Change: F335L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031640
Gene: ENSMUSG00000029635
AA Change: F335L

DomainStartEndE-ValueType
S_TKc 21 335 1.89e-83 SMART
low complexity region 372 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160924
Predicted Effect probably damaging
Transcript: ENSMUST00000161181
AA Change: F270L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000125668
Gene: ENSMUSG00000029635
AA Change: F270L

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 179 6e-16 PFAM
Pfam:Pkinase 1 270 1.6e-44 PFAM
low complexity region 307 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162494
SMART Domains Protein: ENSMUSP00000125516
Gene: ENSMUSG00000029635

DomainStartEndE-ValueType
Pfam:Pkinase 22 153 5.9e-25 PFAM
Pfam:Pkinase_Tyr 22 156 1.5e-15 PFAM
Meta Mutation Damage Score 0.8454 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele die prior to implantation exhibiting fragmented blastomeres and failure to undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dync2h1 T A 9: 7,113,153 H224L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Cdk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Cdk8 APN 5 146295163 splice site probably null
R1132:Cdk8 UTSW 5 146299815 missense probably benign 0.09
R1513:Cdk8 UTSW 5 146296378 missense possibly damaging 0.93
R2231:Cdk8 UTSW 5 146231604 start gained probably benign
R3692:Cdk8 UTSW 5 146283668 nonsense probably null
R4157:Cdk8 UTSW 5 146299449 intron probably benign
R4760:Cdk8 UTSW 5 146292666 missense probably benign 0.15
R4804:Cdk8 UTSW 5 146296399 missense probably damaging 1.00
R5119:Cdk8 UTSW 5 146283627 critical splice acceptor site probably null
R6633:Cdk8 UTSW 5 146298846 nonsense probably null
R6755:Cdk8 UTSW 5 146268316 missense probably damaging 1.00
R7442:Cdk8 UTSW 5 146292769 critical splice donor site probably null
R7936:Cdk8 UTSW 5 146299834 missense possibly damaging 0.49
R8083:Cdk8 UTSW 5 146268290 missense probably damaging 1.00
R8315:Cdk8 UTSW 5 146268251 missense probably damaging 1.00
R9159:Cdk8 UTSW 5 146231739 missense probably damaging 1.00
Z1177:Cdk8 UTSW 5 146299795 missense probably damaging 0.96
Z1177:Cdk8 UTSW 5 146299796 missense probably damaging 0.99
Z1177:Cdk8 UTSW 5 146301637 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTCTGGATGTGACAGGGATGAGC -3'
(R):5'- TGAACGCATCACTGAGTAAGAGGC -3'

Sequencing Primer
(F):5'- ttggtgatgtttttattttccatctg -3'
(R):5'- GTAAGAGGCATCCATTTCAGC -3'
Posted On 2013-06-12