Incidental Mutation 'R0506:Dync2h1'
ID47590
Institutional Source Beutler Lab
Gene Symbol Dync2h1
Ensembl Gene ENSMUSG00000047193
Gene Namedynein cytoplasmic 2 heavy chain 1
Synonyms4432416O06Rik, DHC2, D030010H02Rik, D330044F14Rik, Dnchc2, DHC1b, b2b414Clo
MMRRC Submission 038701-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0506 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location6928503-7184446 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7113153 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 224 (H224L)
Ref Sequence ENSEMBL: ENSMUSP00000149764 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048417] [ENSMUST00000140466] [ENSMUST00000147193] [ENSMUST00000216097]
Predicted Effect probably benign
Transcript: ENSMUST00000048417
AA Change: H2457L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000046733
Gene: ENSMUSG00000047193
AA Change: H2457L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000139671
SMART Domains Protein: ENSMUSP00000116242
Gene: ENSMUSG00000047193

DomainStartEndE-ValueType
low complexity region 59 73 N/A INTRINSIC
Pfam:AAA_8 89 352 3e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140466
AA Change: H2457L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000120007
Gene: ENSMUSG00000047193
AA Change: H2457L

DomainStartEndE-ValueType
Pfam:DHC_N1 187 676 1.6e-43 PFAM
Pfam:DHC_N2 1117 1523 4.1e-120 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2881 6.8e-27 PFAM
Pfam:MT 2894 3230 5.4e-28 PFAM
Pfam:AAA_9 3242 3471 1.1e-50 PFAM
Pfam:Dynein_heavy 3605 4304 2.3e-136 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000147193
AA Change: H2457L

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000116679
Gene: ENSMUSG00000047193
AA Change: H2457L

DomainStartEndE-ValueType
Pfam:DHC_N1 188 674 4e-45 PFAM
Pfam:DHC_N2 1118 1521 5.5e-111 PFAM
AAA 1684 1830 3.72e-2 SMART
AAA 1971 2127 2.18e0 SMART
AAA 2283 2431 1.66e0 SMART
low complexity region 2588 2602 N/A INTRINSIC
Pfam:AAA_8 2618 2880 4.4e-27 PFAM
Pfam:MT 2894 3230 1.3e-27 PFAM
Pfam:AAA_9 3246 3477 1e-79 PFAM
Pfam:Dynein_heavy 3618 4310 8.5e-158 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000214191
AA Change: H155L
Predicted Effect probably benign
Transcript: ENSMUST00000216097
AA Change: H224L

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
Meta Mutation Damage Score 0.1722 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.7%
  • 20x: 93.3%
Validation Efficiency 100% (100/100)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large cytoplasmic dynein protein that is involved in retrograde transport in the cilium and has a role in intraflagellar transport, a process required for ciliary/flagellar assembly. Mutations in this gene cause a heterogeneous spectrum of conditions related to altered primary cilium function and often involve polydactyly, abnormal skeletogenesis, and polycystic kidneys. Alternative splicing results in multiple transcript variants encoding distinct proteins. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygotes for a gene trap allele show complete embryonic lethality with altered heart looping and brain morphology. Chemically induced mutants show randomized heart looping and polydactyly. Holoprosencephaly or exencephaly, micrognathia, and cardiac, renal, airway and eye defects may be observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 97 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm5 T A 7: 119,538,096 C378* probably null Het
Ago3 T C 4: 126,417,252 D56G possibly damaging Het
Ahnak G T 19: 9,009,128 G2592V probably damaging Het
Aldh6a1 C T 12: 84,433,526 G470D probably damaging Het
Ankub1 T A 3: 57,690,375 N58I probably damaging Het
Apol7b G T 15: 77,425,528 T23K probably benign Het
Arap2 G A 5: 62,606,131 P1557S possibly damaging Het
Arhgap24 T C 5: 102,875,777 Y136H probably damaging Het
Atp1a1 A G 3: 101,589,812 F393L probably damaging Het
Bcdin3d A T 15: 99,470,992 C109S probably damaging Het
Catsperd A G 17: 56,658,078 K475R possibly damaging Het
Cblb A G 16: 52,204,480 T913A probably benign Het
Cbx6 A G 15: 79,828,203 L341P probably benign Het
Cd177 T C 7: 24,758,356 Y159C probably damaging Het
Cdh7 A G 1: 110,100,114 N530D probably damaging Het
Cdk8 T C 5: 146,298,872 F270L probably damaging Het
Ces2c A T 8: 104,848,024 T38S probably damaging Het
Chst14 T C 2: 118,927,721 L357P probably damaging Het
Clca3b T A 3: 144,822,866 probably benign Het
Cluh A G 11: 74,664,894 S839G probably benign Het
Cnga4 T A 7: 105,407,740 V350E probably damaging Het
Creb1 G A 1: 64,570,267 G180R probably damaging Het
Csmd3 T C 15: 48,457,511 E301G probably benign Het
Cyp4f18 A T 8: 71,996,000 D268E probably benign Het
Dock5 A G 14: 67,784,792 probably benign Het
Dpy19l4 T A 4: 11,289,715 H332L probably benign Het
Dzip1l C A 9: 99,663,081 Q585K possibly damaging Het
Erf C T 7: 25,244,376 G510D probably damaging Het
Fanci T C 7: 79,432,178 L623P probably benign Het
Fat1 T C 8: 45,022,951 V1655A probably damaging Het
Fat4 T C 3: 38,888,314 V452A probably benign Het
Gal3st4 C T 5: 138,265,889 G283S probably benign Het
Gm5422 A G 10: 31,250,322 noncoding transcript Het
Gnal C T 18: 67,088,673 T49I unknown Het
Gng5 A G 3: 146,503,348 N57S probably damaging Het
Herc1 A G 9: 66,448,159 I2231V probably damaging Het
Hgfac G T 5: 35,044,240 G272W probably damaging Het
Hmcn1 T A 1: 150,742,341 D1265V possibly damaging Het
Ifi207 T A 1: 173,736,312 Q47L possibly damaging Het
Klhl40 G A 9: 121,778,067 E98K probably damaging Het
Lepr G T 4: 101,773,010 probably benign Het
Lyst A G 13: 13,638,015 H1004R probably benign Het
Map3k1 T A 13: 111,755,764 R986* probably null Het
Mmp1b C A 9: 7,387,013 Q66H possibly damaging Het
Mpo T C 11: 87,803,504 S107P probably benign Het
Mroh9 T C 1: 163,060,636 H290R possibly damaging Het
Myo7b A G 18: 31,964,386 probably null Het
Myom1 T C 17: 71,092,220 probably benign Het
Nalcn C T 14: 123,596,614 V50I possibly damaging Het
Negr1 A G 3: 157,160,748 probably benign Het
Nlrc5 T G 8: 94,493,125 probably benign Het
Nyap2 G A 1: 81,087,312 D14N probably damaging Het
Olfr1458 G A 19: 13,103,278 R3C possibly damaging Het
Olfr1490 T A 19: 13,654,897 I151N possibly damaging Het
Olfr91 C A 17: 37,093,311 G188W probably damaging Het
Parp14 A T 16: 35,841,409 S1419T possibly damaging Het
Piezo2 A G 18: 63,027,544 F2347S probably damaging Het
Pigf A G 17: 87,008,909 V147A probably benign Het
Pkhd1 A T 1: 20,559,469 M637K probably benign Het
Plce1 T C 19: 38,760,138 I1771T probably benign Het
Ppp6c A T 2: 39,206,648 probably benign Het
Prag1 T C 8: 36,103,700 V479A possibly damaging Het
Prss33 A T 17: 23,835,105 D42E probably benign Het
Psmb10 A G 8: 105,937,545 V64A possibly damaging Het
Psmd14 A G 2: 61,800,063 T306A probably benign Het
Psmg1 C T 16: 95,989,487 probably benign Het
Rc3h2 A T 2: 37,376,659 probably null Het
Reln C T 5: 21,920,496 V2730I probably damaging Het
Sec24a A T 11: 51,743,795 H101Q probably benign Het
Selenoi A G 5: 30,266,956 N385S probably benign Het
Slc24a4 T C 12: 102,131,623 probably null Het
Slc4a10 G A 2: 62,250,533 S338N probably benign Het
Slfn3 A T 11: 83,213,160 T286S probably damaging Het
Snx29 A G 16: 11,395,303 D111G probably benign Het
Sp8 T C 12: 118,848,565 S52P possibly damaging Het
Srek1 G T 13: 103,760,590 T81K probably damaging Het
Sry C G Y: 2,662,864 Q265H unknown Het
Taf3 A G 2: 9,940,993 V600A probably benign Het
Tatdn2 C A 6: 113,702,589 D298E probably benign Het
Tmem253 A T 14: 52,017,206 probably benign Het
Tmem63a T A 1: 180,958,049 probably null Het
Tmprss11b T C 5: 86,661,640 D331G probably damaging Het
Tor1aip1 T A 1: 156,007,674 K143* probably null Het
Trappc8 A T 18: 20,844,188 N841K possibly damaging Het
Trio T C 15: 27,854,963 Q711R probably benign Het
Trmt10b C A 4: 45,304,306 T114N probably damaging Het
Trpv2 C A 11: 62,582,906 A129D probably benign Het
Ttll4 T G 1: 74,688,618 D846E probably benign Het
Ugt2a3 A G 5: 87,336,649 L172P possibly damaging Het
Usp19 T A 9: 108,494,487 F355Y probably damaging Het
Vmn1r209 C T 13: 22,805,944 G192D probably damaging Het
Vmn2r107 T G 17: 20,357,759 D443E probably benign Het
Wee2 A T 6: 40,463,253 E445V probably benign Het
Zer1 A T 2: 30,101,807 I680N probably damaging Het
Zfhx4 T C 3: 5,402,735 L2651P probably damaging Het
Zfp692 C T 11: 58,309,055 Q157* probably null Het
Zfp964 T A 8: 69,663,937 C396S unknown Het
Other mutations in Dync2h1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dync2h1 APN 9 7158839 missense probably benign 0.42
IGL00310:Dync2h1 APN 9 7155072 splice site probably benign
IGL00499:Dync2h1 APN 9 7168700 missense possibly damaging 0.95
IGL00579:Dync2h1 APN 9 7035728 splice site probably benign
IGL00660:Dync2h1 APN 9 7075797 missense probably damaging 0.98
IGL00964:Dync2h1 APN 9 7174881 splice site probably benign
IGL01025:Dync2h1 APN 9 7162789 missense probably damaging 1.00
IGL01093:Dync2h1 APN 9 7145611 missense probably benign 0.01
IGL01108:Dync2h1 APN 9 7176771 missense possibly damaging 0.87
IGL01126:Dync2h1 APN 9 7116588 missense probably benign 0.00
IGL01474:Dync2h1 APN 9 7102493 missense probably benign 0.01
IGL01531:Dync2h1 APN 9 7071111 missense probably benign 0.11
IGL01548:Dync2h1 APN 9 7071922 missense probably damaging 1.00
IGL01621:Dync2h1 APN 9 7140897 critical splice donor site probably null
IGL01672:Dync2h1 APN 9 7118884 nonsense probably null
IGL01681:Dync2h1 APN 9 7142196 splice site probably null
IGL01685:Dync2h1 APN 9 7142297 missense probably damaging 1.00
IGL01724:Dync2h1 APN 9 7081077 missense probably benign 0.03
IGL01738:Dync2h1 APN 9 7114922 missense possibly damaging 0.77
IGL01783:Dync2h1 APN 9 7118822 unclassified probably benign
IGL01813:Dync2h1 APN 9 7122799 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7114973 missense probably damaging 1.00
IGL01931:Dync2h1 APN 9 7011207 missense probably benign 0.33
IGL02105:Dync2h1 APN 9 7075892 missense probably damaging 1.00
IGL02137:Dync2h1 APN 9 7134349 missense probably benign
IGL02140:Dync2h1 APN 9 7147791 missense probably benign
IGL02175:Dync2h1 APN 9 7111548 missense possibly damaging 0.91
IGL02283:Dync2h1 APN 9 7125912 missense probably damaging 0.99
IGL02305:Dync2h1 APN 9 7122678 missense probably benign
IGL02342:Dync2h1 APN 9 7142246 missense probably damaging 1.00
IGL02367:Dync2h1 APN 9 7158926 missense probably damaging 0.98
IGL02458:Dync2h1 APN 9 7117422 missense probably damaging 1.00
IGL02563:Dync2h1 APN 9 7035700 missense possibly damaging 0.95
IGL02825:Dync2h1 APN 9 6955901 splice site probably benign
IGL02955:Dync2h1 APN 9 7142864 missense probably benign 0.00
IGL02992:Dync2h1 APN 9 7137074 missense probably benign 0.01
IGL02996:Dync2h1 APN 9 6935279 missense probably damaging 0.99
IGL03224:Dync2h1 APN 9 7076235 missense probably benign 0.32
IGL03226:Dync2h1 APN 9 7125918 missense probably benign
IGL03233:Dync2h1 APN 9 7101525 missense possibly damaging 0.90
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0016:Dync2h1 UTSW 9 7144346 splice site probably benign
R0043:Dync2h1 UTSW 9 7005574 missense probably benign 0.05
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0109:Dync2h1 UTSW 9 7111487 missense probably damaging 1.00
R0121:Dync2h1 UTSW 9 7001327 splice site probably benign
R0277:Dync2h1 UTSW 9 7129046 missense probably benign
R0360:Dync2h1 UTSW 9 7113182 missense possibly damaging 0.62
R0362:Dync2h1 UTSW 9 7005487 splice site probably null
R0389:Dync2h1 UTSW 9 7167244 splice site probably null
R0443:Dync2h1 UTSW 9 7167244 splice site probably null
R0496:Dync2h1 UTSW 9 7155180 missense probably benign 0.42
R0511:Dync2h1 UTSW 9 7122692 missense probably benign 0.00
R0540:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0550:Dync2h1 UTSW 9 7120954 intron probably null
R0564:Dync2h1 UTSW 9 7139432 missense probably damaging 1.00
R0607:Dync2h1 UTSW 9 7051480 missense probably benign 0.00
R0699:Dync2h1 UTSW 9 7103680 missense probably benign 0.00
R0725:Dync2h1 UTSW 9 7015497 missense possibly damaging 0.93
R0835:Dync2h1 UTSW 9 7116642 critical splice acceptor site probably null
R0837:Dync2h1 UTSW 9 7077979 missense probably benign 0.07
R0894:Dync2h1 UTSW 9 7041734 splice site probably benign
R0938:Dync2h1 UTSW 9 7002658 missense probably benign 0.02
R1056:Dync2h1 UTSW 9 7147731 missense probably benign 0.15
R1081:Dync2h1 UTSW 9 7005488 critical splice donor site probably null
R1178:Dync2h1 UTSW 9 7101193 splice site probably benign
R1243:Dync2h1 UTSW 9 7120882 missense probably benign
R1295:Dync2h1 UTSW 9 7075752 splice site probably benign
R1304:Dync2h1 UTSW 9 7102318 missense probably damaging 1.00
R1387:Dync2h1 UTSW 9 7125816 missense probably benign
R1513:Dync2h1 UTSW 9 7103663 missense possibly damaging 0.74
R1557:Dync2h1 UTSW 9 7140911 missense probably damaging 1.00
R1568:Dync2h1 UTSW 9 7157553 missense probably null 0.02
R1570:Dync2h1 UTSW 9 7176926 missense probably benign 0.12
R1670:Dync2h1 UTSW 9 6993942 missense possibly damaging 0.82
R1713:Dync2h1 UTSW 9 7131891 missense probably benign
R1766:Dync2h1 UTSW 9 7015526 critical splice acceptor site probably null
R1773:Dync2h1 UTSW 9 7128256 missense probably damaging 1.00
R1786:Dync2h1 UTSW 9 7081084 missense probably damaging 1.00
R1848:Dync2h1 UTSW 9 7049166 missense probably benign 0.01
R1850:Dync2h1 UTSW 9 7001448 missense probably benign 0.00
R1935:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1936:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1937:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1939:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1940:Dync2h1 UTSW 9 7139159 critical splice donor site probably null
R1944:Dync2h1 UTSW 9 7001377 missense probably damaging 1.00
R1976:Dync2h1 UTSW 9 7129045 missense probably benign
R2012:Dync2h1 UTSW 9 7169589 missense probably benign 0.00
R2020:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2020:Dync2h1 UTSW 9 7162925 missense probably benign 0.25
R2024:Dync2h1 UTSW 9 7129062 missense probably damaging 0.97
R2038:Dync2h1 UTSW 9 6967226 missense probably damaging 0.99
R2045:Dync2h1 UTSW 9 7160171 missense probably damaging 1.00
R2060:Dync2h1 UTSW 9 7162802 missense possibly damaging 0.92
R2094:Dync2h1 UTSW 9 7148735 missense probably benign 0.18
R2129:Dync2h1 UTSW 9 7175289 missense possibly damaging 0.94
R2130:Dync2h1 UTSW 9 7011253 missense probably damaging 1.00
R2136:Dync2h1 UTSW 9 7122772 missense probably damaging 0.99
R2164:Dync2h1 UTSW 9 7124797 missense probably damaging 1.00
R2242:Dync2h1 UTSW 9 7037828 splice site probably null
R2255:Dync2h1 UTSW 9 6955905 critical splice donor site probably null
R2357:Dync2h1 UTSW 9 7081053 missense probably benign 0.03
R2389:Dync2h1 UTSW 9 7122618 missense possibly damaging 0.82
R2412:Dync2h1 UTSW 9 7144246 missense probably benign 0.01
R2885:Dync2h1 UTSW 9 7102329 missense probably damaging 1.00
R2909:Dync2h1 UTSW 9 7049114 missense probably damaging 1.00
R3434:Dync2h1 UTSW 9 7011236 missense probably benign
R3719:Dync2h1 UTSW 9 7006882 splice site probably benign
R3723:Dync2h1 UTSW 9 7041658 missense probably benign 0.17
R3800:Dync2h1 UTSW 9 7101525 missense possibly damaging 0.90
R3803:Dync2h1 UTSW 9 6935293 missense probably benign 0.00
R3936:Dync2h1 UTSW 9 7001482 missense probably damaging 1.00
R3941:Dync2h1 UTSW 9 7124825 missense probably benign
R3950:Dync2h1 UTSW 9 7112061 nonsense probably null
R4004:Dync2h1 UTSW 9 7117404 missense probably damaging 1.00
R4091:Dync2h1 UTSW 9 7131881 missense probably benign 0.01
R4233:Dync2h1 UTSW 9 7134360 missense probably benign 0.02
R4302:Dync2h1 UTSW 9 7077880 missense probably benign 0.02
R4451:Dync2h1 UTSW 9 6983477 missense probably benign 0.02
R4512:Dync2h1 UTSW 9 7085009 nonsense probably null
R4596:Dync2h1 UTSW 9 6992595 missense probably benign
R4604:Dync2h1 UTSW 9 7140995 missense probably benign 0.00
R4614:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R4667:Dync2h1 UTSW 9 7051411 missense probably benign 0.00
R4671:Dync2h1 UTSW 9 7169640 missense possibly damaging 0.82
R4714:Dync2h1 UTSW 9 7118932 missense possibly damaging 0.86
R4716:Dync2h1 UTSW 9 7142648 critical splice donor site probably null
R4736:Dync2h1 UTSW 9 7006862 missense probably benign 0.00
R4807:Dync2h1 UTSW 9 7139422 missense probably benign 0.31
R4850:Dync2h1 UTSW 9 7134364 missense probably benign 0.14
R4862:Dync2h1 UTSW 9 7147717 missense probably benign
R4899:Dync2h1 UTSW 9 7131921 nonsense probably null
R4971:Dync2h1 UTSW 9 7131949 missense probably benign
R5040:Dync2h1 UTSW 9 6992625 missense probably benign 0.09
R5054:Dync2h1 UTSW 9 7085007 missense possibly damaging 0.63
R5274:Dync2h1 UTSW 9 7116540 missense probably benign 0.00
R5307:Dync2h1 UTSW 9 7155099 missense probably damaging 1.00
R5347:Dync2h1 UTSW 9 7129727 missense probably damaging 1.00
R5372:Dync2h1 UTSW 9 7176962 unclassified probably benign
R5384:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5385:Dync2h1 UTSW 9 7016791 missense probably damaging 0.99
R5394:Dync2h1 UTSW 9 7120899 nonsense probably null
R5402:Dync2h1 UTSW 9 7114949 missense probably damaging 1.00
R5446:Dync2h1 UTSW 9 7144217 missense probably benign
R5538:Dync2h1 UTSW 9 7168630 intron probably benign
R5551:Dync2h1 UTSW 9 7031718 missense possibly damaging 0.74
R5619:Dync2h1 UTSW 9 7118885 missense probably benign 0.02
R5621:Dync2h1 UTSW 9 7120909 missense possibly damaging 0.86
R5652:Dync2h1 UTSW 9 7116638 missense probably benign 0.45
R5655:Dync2h1 UTSW 9 7148659 missense probably benign 0.01
R5689:Dync2h1 UTSW 9 7169689 missense probably damaging 1.00
R5725:Dync2h1 UTSW 9 7169528 missense probably benign 0.21
R5742:Dync2h1 UTSW 9 7165762 missense possibly damaging 0.64
R5817:Dync2h1 UTSW 9 6996905 missense probably damaging 1.00
R5852:Dync2h1 UTSW 9 7011290 missense probably benign 0.03
R5898:Dync2h1 UTSW 9 7148717 missense probably benign 0.00
R5916:Dync2h1 UTSW 9 7102309 critical splice donor site probably null
R5939:Dync2h1 UTSW 9 7037801 missense probably damaging 0.99
R5942:Dync2h1 UTSW 9 7117466 nonsense probably null
R5982:Dync2h1 UTSW 9 6955986 missense probably benign 0.00
R6029:Dync2h1 UTSW 9 7157646 missense probably benign
R6125:Dync2h1 UTSW 9 7168706 missense probably damaging 1.00
R6209:Dync2h1 UTSW 9 7165677 missense probably benign 0.01
R6247:Dync2h1 UTSW 9 7135078 missense probably damaging 1.00
R6294:Dync2h1 UTSW 9 7084986 missense probably benign 0.01
R6328:Dync2h1 UTSW 9 7165717 missense probably benign 0.00
R6376:Dync2h1 UTSW 9 7165703 missense probably benign 0.21
R6394:Dync2h1 UTSW 9 7168331 missense probably damaging 0.99
R6539:Dync2h1 UTSW 9 7159478 splice site probably null
R6554:Dync2h1 UTSW 9 7037699 missense probably benign 0.39
R6559:Dync2h1 UTSW 9 7139501 missense possibly damaging 0.72
R6563:Dync2h1 UTSW 9 7120819 missense probably benign 0.27
R6807:Dync2h1 UTSW 9 7041718 missense probably benign 0.10
R6848:Dync2h1 UTSW 9 7159632 missense probably benign 0.22
R6901:Dync2h1 UTSW 9 7131855 missense probably damaging 1.00
R6921:Dync2h1 UTSW 9 7102549 missense probably benign
R6997:Dync2h1 UTSW 9 7168743 missense probably null 0.00
R7084:Dync2h1 UTSW 9 7113214 missense possibly damaging 0.72
R7113:Dync2h1 UTSW 9 7075788 missense probably benign 0.03
R7131:Dync2h1 UTSW 9 7075786 missense probably damaging 1.00
R7165:Dync2h1 UTSW 9 7050479 missense probably benign
R7196:Dync2h1 UTSW 9 7147715 nonsense probably null
R7208:Dync2h1 UTSW 9 7141059 missense probably damaging 1.00
R7225:Dync2h1 UTSW 9 7142756 missense probably benign
R7237:Dync2h1 UTSW 9 6993966 missense probably benign 0.00
R7243:Dync2h1 UTSW 9 7102405 missense possibly damaging 0.64
R7291:Dync2h1 UTSW 9 6929590 missense possibly damaging 0.69
R7293:Dync2h1 UTSW 9 7001454 missense possibly damaging 0.88
R7329:Dync2h1 UTSW 9 7011247 missense probably benign
R7351:Dync2h1 UTSW 9 7167145 missense probably damaging 1.00
R7358:Dync2h1 UTSW 9 7159479 critical splice donor site probably null
R7387:Dync2h1 UTSW 9 7157932 missense possibly damaging 0.68
R7446:Dync2h1 UTSW 9 7041720 missense probably benign 0.03
R7487:Dync2h1 UTSW 9 7132041 missense probably benign 0.26
R7488:Dync2h1 UTSW 9 7124855 missense probably benign 0.03
R7496:Dync2h1 UTSW 9 7135015 splice site probably null
R7501:Dync2h1 UTSW 9 7175336 missense possibly damaging 0.82
R7571:Dync2h1 UTSW 9 7002623 missense probably damaging 1.00
R7627:Dync2h1 UTSW 9 7101111 missense probably benign 0.00
R7639:Dync2h1 UTSW 9 7141254 missense probably damaging 0.97
R7653:Dync2h1 UTSW 9 7117570 missense probably benign
R7654:Dync2h1 UTSW 9 7122664 missense probably damaging 1.00
R7742:Dync2h1 UTSW 9 7076232 missense probably benign 0.00
R7755:Dync2h1 UTSW 9 7015490 missense probably benign 0.00
R7762:Dync2h1 UTSW 9 7129719 missense probably benign 0.01
R7790:Dync2h1 UTSW 9 7114914 missense probably damaging 0.96
X0009:Dync2h1 UTSW 9 7117576 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCCTAGCCAGCCTTGTAAAAGCATC -3'
(R):5'- TCCTGTTCAAATCCCTGGGTAGCC -3'

Sequencing Primer
(F):5'- TGTCTAGCAGCATGTAACCTG -3'
(R):5'- CAAATCCCTGGGTAGCCTTAGAG -3'
Posted On2013-06-12