Incidental Mutation 'R6027:Fam217a'
ID480128
Institutional Source Beutler Lab
Gene Symbol Fam217a
Ensembl Gene ENSMUSG00000021414
Gene Namefamily with sequence similarity 217, member A
Synonyms
MMRRC Submission 044199-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6027 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location34909960-34924310 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34910994 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 170 (T170S)
Ref Sequence ENSEMBL: ENSMUSP00000153128 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021851] [ENSMUST00000077853] [ENSMUST00000223834] [ENSMUST00000225242]
Predicted Effect possibly damaging
Transcript: ENSMUST00000021851
AA Change: T261S

PolyPhen 2 Score 0.707 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000021851
Gene: ENSMUSG00000021414
AA Change: T261S

DomainStartEndE-ValueType
low complexity region 5 19 N/A INTRINSIC
Pfam:FAM217 206 411 2e-54 PFAM
low complexity region 425 436 N/A INTRINSIC
low complexity region 444 455 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000077853
SMART Domains Protein: ENSMUSP00000077019
Gene: ENSMUSG00000021413

DomainStartEndE-ValueType
low complexity region 40 62 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
coiled coil region 102 123 N/A INTRINSIC
low complexity region 142 150 N/A INTRINSIC
low complexity region 156 170 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
low complexity region 210 233 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
low complexity region 284 294 N/A INTRINSIC
low complexity region 299 324 N/A INTRINSIC
low complexity region 340 360 N/A INTRINSIC
low complexity region 390 417 N/A INTRINSIC
low complexity region 435 497 N/A INTRINSIC
low complexity region 521 535 N/A INTRINSIC
low complexity region 562 581 N/A INTRINSIC
S_TKc 687 1003 4.99e-74 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220965
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221156
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223228
Predicted Effect probably benign
Transcript: ENSMUST00000223834
AA Change: T413S

PolyPhen 2 Score 0.444 (Sensitivity: 0.89; Specificity: 0.90)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224613
Predicted Effect possibly damaging
Transcript: ENSMUST00000225242
AA Change: T170S

PolyPhen 2 Score 0.766 (Sensitivity: 0.85; Specificity: 0.92)
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (68/68)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acaca T C 11: 84,398,177 V2299A probably benign Het
Acacb A G 5: 114,165,600 D28G probably benign Het
Adamts6 G A 13: 104,479,535 G1035D probably damaging Het
Adamts7 A C 9: 90,191,025 Y755S probably damaging Het
Afg3l2 G T 18: 67,421,259 L458M probably damaging Het
Ank2 T C 3: 126,997,879 T763A possibly damaging Het
Armc9 G C 1: 86,244,667 L105F probably damaging Het
Asah2 T C 19: 32,044,951 N228D probably benign Het
Ash1l T C 3: 88,985,019 Y1402H probably damaging Het
Aspm T G 1: 139,463,056 V693G probably damaging Het
Bptf T C 11: 107,074,945 E1141G probably damaging Het
Col12a1 C T 9: 79,656,578 probably null Het
Csmd2 G A 4: 128,559,946 D3475N unknown Het
Dctn5 T C 7: 122,133,341 probably benign Het
Dhrs4 A G 14: 55,486,123 K18E probably benign Het
Eci2 A T 13: 34,985,947 probably null Het
Efcab6 A G 15: 83,967,721 F319L probably benign Het
Elane A T 10: 79,887,018 H86L probably damaging Het
Endod1 A T 9: 14,357,597 Y197* probably null Het
Eno4 A G 19: 58,946,830 D158G probably damaging Het
Fbxo7 A G 10: 86,048,086 D517G probably damaging Het
Fkbp3 G T 12: 65,073,918 A2E possibly damaging Het
Gan A G 8: 117,158,295 Y54C probably damaging Het
Gdap1l1 T A 2: 163,451,611 N194K possibly damaging Het
Gm15448 T C 7: 3,824,639 Y173C possibly damaging Het
Gnptab A G 10: 88,433,225 T597A probably damaging Het
Hmcn1 A G 1: 150,802,895 S492P possibly damaging Het
Hmox1 C A 8: 75,096,871 H56N probably damaging Het
Kank3 C T 17: 33,818,114 P131S possibly damaging Het
Kif14 T C 1: 136,483,059 probably null Het
Kif1a A T 1: 93,025,643 M1274K probably benign Het
Kmt2a A T 9: 44,819,290 probably benign Het
Lypla1 T C 1: 4,837,076 probably null Het
Man2b1 C T 8: 85,096,752 T905I probably damaging Het
Mmp15 C A 8: 95,372,176 H544N probably benign Het
Myh7 A T 14: 54,970,802 N1933K probably benign Het
Ndst4 G T 3: 125,713,376 A730S probably benign Het
Nmur1 G A 1: 86,387,331 Q238* probably null Het
Nwd2 C T 5: 63,808,220 P1716S possibly damaging Het
Olfr1085 T G 2: 86,657,804 Y218S probably damaging Het
Olfr157 A G 4: 43,835,842 V216A probably benign Het
Olfr883 ATTGCTGTTT ATTGCTGTTTGCTGTTT 9: 38,026,540 probably null Het
P2ry6 T G 7: 100,938,508 M215L probably benign Het
Parp4 G A 14: 56,629,158 E1060K probably benign Het
Pde10a A G 17: 8,964,677 I822V possibly damaging Het
Pkd1l1 C A 11: 8,916,272 G528* probably null Het
Ptk2 T A 15: 73,229,913 Q816L probably damaging Het
Ptprg T C 14: 12,220,613 F442L possibly damaging Het
Qrfpr A G 3: 36,222,038 Y68H probably benign Het
Ripk4 A G 16: 97,744,074 W458R probably damaging Het
Ros1 G T 10: 52,163,968 T309N possibly damaging Het
Rps27a T C 11: 29,547,808 probably benign Het
Sarm1 T A 11: 78,483,558 M577L probably benign Het
Scin T C 12: 40,077,516 Y425C probably damaging Het
Serpina12 T A 12: 104,031,077 Y395F probably benign Het
Sfxn2 T A 19: 46,582,852 Y69* probably null Het
Skint6 T C 4: 113,096,564 probably null Het
Slc7a1 A C 5: 148,333,964 I564S possibly damaging Het
Smc6 T A 12: 11,306,178 Y933N probably benign Het
Sp110 T C 1: 85,577,318 S438G possibly damaging Het
St8sia4 T A 1: 95,653,674 R114S probably damaging Het
Trim11 C T 11: 58,978,463 A75V possibly damaging Het
Tufm T A 7: 126,487,748 H68Q probably damaging Het
Ythdc2 T A 18: 44,860,436 D194E probably benign Het
Other mutations in Fam217a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01386:Fam217a APN 13 34915649 splice site probably benign
IGL02222:Fam217a APN 13 34911119 missense probably damaging 1.00
IGL02302:Fam217a APN 13 34911161 missense probably damaging 1.00
IGL02371:Fam217a APN 13 34911401 missense possibly damaging 0.53
IGL02538:Fam217a APN 13 34911113 missense probably damaging 0.98
R0324:Fam217a UTSW 13 34910961 missense possibly damaging 0.71
R0616:Fam217a UTSW 13 34913683 missense probably benign 0.03
R1497:Fam217a UTSW 13 34911212 missense probably damaging 0.97
R1934:Fam217a UTSW 13 34910881 missense probably damaging 1.00
R1981:Fam217a UTSW 13 34916754 missense probably benign 0.07
R2133:Fam217a UTSW 13 34913680 missense probably damaging 1.00
R2344:Fam217a UTSW 13 34910335 missense probably damaging 1.00
R4182:Fam217a UTSW 13 34910256 missense possibly damaging 0.75
R4601:Fam217a UTSW 13 34911302 missense probably damaging 1.00
R4909:Fam217a UTSW 13 34910406 missense probably damaging 1.00
R5583:Fam217a UTSW 13 34910297 missense probably damaging 1.00
R6496:Fam217a UTSW 13 34910802 nonsense probably null
R7166:Fam217a UTSW 13 34910315 missense probably benign 0.07
R7394:Fam217a UTSW 13 34910279 missense possibly damaging 0.73
R7710:Fam217a UTSW 13 34911128 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- TCTGCCATTGAAAACATGGAGC -3'
(R):5'- TTCAAATACAGAAACAGCAGTGTGG -3'

Sequencing Primer
(F):5'- GCTATAGAAAGTGCTTTGCAGCC -3'
(R):5'- CAGCAGTGTGGAAGAAAATGTCAC -3'
Posted On2017-06-26