Mutagenetix > Incidental Mutation

Incidental Mutation 'R6027:Ptk2'

480134

Institutional Source

Beutler Lab

Gene Symbol

Ptk2

Ensembl Gene

ENSMUSG00000022607

Gene Name

PTK2 protein tyrosine kinase 2

Synonyms

FRNK, FAK, Fadk

MMRRC Submission

044199-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6027 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

73205102-73423280 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 73229913 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Leucine at position 816 (Q816L)

Ref Sequence

ENSEMBL: ENSMUSP00000154242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000110036] [ENSMUST00000170939] [ENSMUST00000226988] [ENSMUST00000227395] [ENSMUST00000227686]

AlphaFold

P34152

Predicted Effect

probably damaging
Transcript: ENSMUST00000110036
AA Change: Q816L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000105663
Gene: ENSMUSG00000022607
AA Change: Q816L

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	288	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC
Pfam:Focal_AT	914	1046	5e-59	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000170939
AA Change: Q816L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126764
Gene: ENSMUSG00000022607
AA Change: Q816L

Domain	Start	End	E-Value	Type
B41	31	258	1.49e-39	SMART
Blast:B41	287	333	1e-19	BLAST
TyrKc	422	676	1.11e-130	SMART
low complexity region	686	698	N/A	INTRINSIC
low complexity region	712	726	N/A	INTRINSIC
low complexity region	863	883	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226742

Predicted Effect

probably damaging
Transcript: ENSMUST00000226988
AA Change: Q816L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000227395

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227569

Predicted Effect

probably benign
Transcript: ENSMUST00000227686

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228628

Meta Mutation Damage Score

0.2674

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (68/68)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a cytoplasmic protein tyrosine kinase which is found concentrated in the focal adhesions that form between cells growing in the presence of extracellular matrix constituents. The encoded protein is a member of the FAK subfamily of protein tyrosine kinases but lacks significant sequence similarity to kinases from other subfamilies. Activation of this gene may be an important early step in cell growth and intracellular signal transduction pathways triggered in response to certain neural peptides or to cell interactions with the extracellular matrix. Several transcript variants encoding different isoforms have been found for this gene, but the full-length natures of only four of them have been determined. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a null allele die before or during organogenesis with growth retardation, abnormal embryonic and extra embryonic tissue development, and abnormal vascular development. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	C	11: 84,398,177	V2299A	probably benign	Het
Acacb	A	G	5: 114,165,600	D28G	probably benign	Het
Adamts6	G	A	13: 104,479,535	G1035D	probably damaging	Het
Adamts7	A	C	9: 90,191,025	Y755S	probably damaging	Het
Afg3l2	G	T	18: 67,421,259	L458M	probably damaging	Het
Ank2	T	C	3: 126,997,879	T763A	possibly damaging	Het
Armc9	G	C	1: 86,244,667	L105F	probably damaging	Het
Asah2	T	C	19: 32,044,951	N228D	probably benign	Het
Ash1l	T	C	3: 88,985,019	Y1402H	probably damaging	Het
Aspm	T	G	1: 139,463,056	V693G	probably damaging	Het
Bptf	T	C	11: 107,074,945	E1141G	probably damaging	Het
Col12a1	C	T	9: 79,656,578		probably null	Het
Csmd2	G	A	4: 128,559,946	D3475N	unknown	Het
Dctn5	T	C	7: 122,133,341		probably benign	Het
Dhrs4	A	G	14: 55,486,123	K18E	probably benign	Het
Eci2	A	T	13: 34,985,947		probably null	Het
Efcab6	A	G	15: 83,967,721	F319L	probably benign	Het
Elane	A	T	10: 79,887,018	H86L	probably damaging	Het
Endod1	A	T	9: 14,357,597	Y197*	probably null	Het
Eno4	A	G	19: 58,946,830	D158G	probably damaging	Het
Fam217a	T	A	13: 34,910,994	T170S	possibly damaging	Het
Fbxo7	A	G	10: 86,048,086	D517G	probably damaging	Het
Fkbp3	G	T	12: 65,073,918	A2E	possibly damaging	Het
Gan	A	G	8: 117,158,295	Y54C	probably damaging	Het
Gdap1l1	T	A	2: 163,451,611	N194K	possibly damaging	Het
Gm15448	T	C	7: 3,824,639	Y173C	possibly damaging	Het
Gnptab	A	G	10: 88,433,225	T597A	probably damaging	Het
Hmcn1	A	G	1: 150,802,895	S492P	possibly damaging	Het
Hmox1	C	A	8: 75,096,871	H56N	probably damaging	Het
Kank3	C	T	17: 33,818,114	P131S	possibly damaging	Het
Kif14	T	C	1: 136,483,059		probably null	Het
Kif1a	A	T	1: 93,025,643	M1274K	probably benign	Het
Kmt2a	A	T	9: 44,819,290		probably benign	Het
Lypla1	T	C	1: 4,837,076		probably null	Het
Man2b1	C	T	8: 85,096,752	T905I	probably damaging	Het
Mmp15	C	A	8: 95,372,176	H544N	probably benign	Het
Myh7	A	T	14: 54,970,802	N1933K	probably benign	Het
Ndst4	G	T	3: 125,713,376	A730S	probably benign	Het
Nmur1	G	A	1: 86,387,331	Q238*	probably null	Het
Nwd2	C	T	5: 63,808,220	P1716S	possibly damaging	Het
Olfr1085	T	G	2: 86,657,804	Y218S	probably damaging	Het
Olfr157	A	G	4: 43,835,842	V216A	probably benign	Het
Olfr883	ATTGCTGTTT	ATTGCTGTTTGCTGTTT	9: 38,026,540		probably null	Het
P2ry6	T	G	7: 100,938,508	M215L	probably benign	Het
Parp4	G	A	14: 56,629,158	E1060K	probably benign	Het
Pde10a	A	G	17: 8,964,677	I822V	possibly damaging	Het
Pkd1l1	C	A	11: 8,916,272	G528*	probably null	Het
Ptprg	T	C	14: 12,220,613	F442L	possibly damaging	Het
Qrfpr	A	G	3: 36,222,038	Y68H	probably benign	Het
Ripk4	A	G	16: 97,744,074	W458R	probably damaging	Het
Ros1	G	T	10: 52,163,968	T309N	possibly damaging	Het
Rps27a	T	C	11: 29,547,808		probably benign	Het
Sarm1	T	A	11: 78,483,558	M577L	probably benign	Het
Scin	T	C	12: 40,077,516	Y425C	probably damaging	Het
Serpina12	T	A	12: 104,031,077	Y395F	probably benign	Het
Sfxn2	T	A	19: 46,582,852	Y69*	probably null	Het
Skint6	T	C	4: 113,096,564		probably null	Het
Slc7a1	A	C	5: 148,333,964	I564S	possibly damaging	Het
Smc6	T	A	12: 11,306,178	Y933N	probably benign	Het
Sp110	T	C	1: 85,577,318	S438G	possibly damaging	Het
St8sia4	T	A	1: 95,653,674	R114S	probably damaging	Het
Trim11	C	T	11: 58,978,463	A75V	possibly damaging	Het
Tufm	T	A	7: 126,487,748	H68Q	probably damaging	Het
Ythdc2	T	A	18: 44,860,436	D194E	probably benign	Het

Other mutations in Ptk2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00861:Ptk2	APN	15	73262547	missense	probably damaging	1.00
IGL00913:Ptk2	APN	15	73295389	splice site	probably benign
IGL01605:Ptk2	APN	15	73264339	splice site	probably benign
IGL01631:Ptk2	APN	15	73216371	missense	probably damaging	1.00
IGL01952:Ptk2	APN	15	73229931	missense	probably damaging	0.99
IGL01957:Ptk2	APN	15	73242473	missense	probably benign	0.05
IGL02441:Ptk2	APN	15	73320826	missense	probably benign	0.16
IGL02471:Ptk2	APN	15	73298187	missense	probably benign	0.41
IGL02621:Ptk2	APN	15	73206145	missense	probably damaging	0.99
IGL03198:Ptk2	APN	15	73236216	missense	probably damaging	1.00
Shooter	UTSW	15	73304444	missense	possibly damaging	0.83
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R0239:Ptk2	UTSW	15	73343283	splice site	probably null
R1254:Ptk2	UTSW	15	73229970	missense	probably benign	0.01
R1291:Ptk2	UTSW	15	73210756	missense	probably damaging	1.00
R1307:Ptk2	UTSW	15	73292046	missense	probably benign	0.01
R1608:Ptk2	UTSW	15	73262575	missense	probably damaging	0.98
R1690:Ptk2	UTSW	15	73262610	missense	probably damaging	1.00
R1724:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1725:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1740:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1741:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R1840:Ptk2	UTSW	15	73210884	missense	probably damaging	1.00
R1956:Ptk2	UTSW	15	73215983	missense	possibly damaging	0.49
R2022:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2092:Ptk2	UTSW	15	73236191	nonsense	probably null
R2114:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2115:Ptk2	UTSW	15	73242406	missense	possibly damaging	0.58
R2336:Ptk2	UTSW	15	73266116	missense	probably damaging	1.00
R2571:Ptk2	UTSW	15	73231919	missense	probably damaging	1.00
R4232:Ptk2	UTSW	15	73309849	missense	possibly damaging	0.61
R4245:Ptk2	UTSW	15	73231976	missense	probably benign	0.00
R4594:Ptk2	UTSW	15	73206196	missense	probably damaging	1.00
R4688:Ptk2	UTSW	15	73206225	missense	probably damaging	1.00
R4834:Ptk2	UTSW	15	73216096	splice site	probably null
R4847:Ptk2	UTSW	15	73231956	missense	probably benign
R5558:Ptk2	UTSW	15	73304445	missense	probably damaging	0.97
R5682:Ptk2	UTSW	15	73262564	nonsense	probably null
R5858:Ptk2	UTSW	15	73321095	missense	probably benign	0.12
R5951:Ptk2	UTSW	15	73303833	missense	possibly damaging	0.88
R6014:Ptk2	UTSW	15	73304444	missense	possibly damaging	0.83
R6082:Ptk2	UTSW	15	73276865	missense	probably damaging	1.00
R7025:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7031:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7032:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7077:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7078:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7079:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7090:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7091:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7092:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7136:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7137:Ptk2	UTSW	15	73221809	missense	possibly damaging	0.46
R7798:Ptk2	UTSW	15	73295375	missense	probably damaging	1.00
R8057:Ptk2	UTSW	15	73298199	frame shift	probably null
R8235:Ptk2	UTSW	15	73343291	missense	probably benign	0.00
R9106:Ptk2	UTSW	15	73259608	missense	possibly damaging	0.95
R9160:Ptk2	UTSW	15	73216084	missense	probably benign	0.01
R9301:Ptk2	UTSW	15	73274497	missense	probably damaging	1.00
R9448:Ptk2	UTSW	15	73343192	missense	possibly damaging	0.78

Predicted Primers

PCR Primer
(F):5'- TACACTAGCACTGAAGTTCTGTG -3'
(R):5'- TCTCAGCCTTCAGAGAGGTG -3'

Sequencing Primer
(F):5'- CACTAGCACTGAAGTTCTGTGAAAAC -3'
(R):5'- CCTTCAGAGAGGTGGCTGGAG -3'

Posted On

2017-06-26