Incidental Mutation 'R6433:Timm22'
ID 518652
Institutional Source Beutler Lab
Gene Symbol Timm22
Ensembl Gene ENSMUSG00000020843
Gene Name translocase of inner mitochondrial membrane 22
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6433 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 76406952-76416292 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76409744 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 114 (V114A)
Ref Sequence ENSEMBL: ENSMUSP00000021203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021203] [ENSMUST00000120699] [ENSMUST00000152183] [ENSMUST00000164102]
AlphaFold Q9CQ85
Predicted Effect possibly damaging
Transcript: ENSMUST00000021203
AA Change: V114A

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021203
Gene: ENSMUSG00000020843
AA Change: V114A

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Pfam:Tim17 68 190 1.5e-33 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000120699
AA Change: V61A

PolyPhen 2 Score 0.529 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000113238
Gene: ENSMUSG00000020843
AA Change: V61A

DomainStartEndE-ValueType
Pfam:Tim17 12 140 4.5e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152183
SMART Domains Protein: ENSMUSP00000123281
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164102
SMART Domains Protein: ENSMUSP00000132836
Gene: ENSMUSG00000020843

DomainStartEndE-ValueType
low complexity region 5 22 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Multipass transmembrane proteins are brought into mitochondria and inserted into the mitochondrial inner membrane by way of the TIM22 complex. This complex has six subunits and is a twin-pore translocase. The protein encoded by this gene is a subunit of TIM22 and represents the voltage-activated and signal-gated channel. [provided by RefSeq, Jul 2016]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Timm22
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01871:Timm22 APN 11 76407437 missense probably damaging 0.98
obsidian UTSW 11 76407119 missense probably benign 0.00
warsling UTSW 11 76414105 missense probably damaging 1.00
R2851:Timm22 UTSW 11 76414099 missense probably damaging 0.97
R6362:Timm22 UTSW 11 76411127 missense probably damaging 0.98
R6388:Timm22 UTSW 11 76407119 missense probably benign 0.00
R6416:Timm22 UTSW 11 76411139 missense probably damaging 1.00
R6707:Timm22 UTSW 11 76407325 missense possibly damaging 0.81
R7054:Timm22 UTSW 11 76407245 missense possibly damaging 0.82
R7469:Timm22 UTSW 11 76407308 missense probably benign 0.11
R8065:Timm22 UTSW 11 76414105 missense probably damaging 1.00
R9541:Timm22 UTSW 11 76409815 missense possibly damaging 0.70
R9569:Timm22 UTSW 11 76407370 missense probably benign 0.06
Z1186:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1187:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1188:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1189:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1190:Timm22 UTSW 11 76407117 missense probably benign 0.00
Z1192:Timm22 UTSW 11 76407117 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGAAAGGCCATCTTCAGTTCTC -3'
(R):5'- AGCTCTTTTACAAGTTGTCCCATG -3'

Sequencing Primer
(F):5'- GTTCTCATCCCAAAATGGTCATTCAG -3'
(R):5'- GAGTTACAATGTAAGACCCTGTCTCC -3'
Posted On 2018-05-24