Incidental Mutation 'R6433:Skint4'
ID518630
Institutional Source Beutler Lab
Gene Symbol Skint4
Ensembl Gene ENSMUSG00000055960
Gene Nameselection and upkeep of intraepithelial T cells 4
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location112072016-112168076 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 112146510 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 380 (K380R)
Ref Sequence ENSEMBL: ENSMUSP00000102176 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069769] [ENSMUST00000106564] [ENSMUST00000106565] [ENSMUST00000106566]
Predicted Effect probably benign
Transcript: ENSMUST00000069769
AA Change: K372R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000070676
Gene: ENSMUSG00000055960
AA Change: K372R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106564
AA Change: K372R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102174
Gene: ENSMUSG00000055960
AA Change: K372R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106565
AA Change: K372R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102175
Gene: ENSMUSG00000055960
AA Change: K372R

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IG 33 140 7.24e-10 SMART
Pfam:C2-set_2 141 227 6.2e-8 PFAM
transmembrane domain 242 264 N/A INTRINSIC
transmembrane domain 296 318 N/A INTRINSIC
transmembrane domain 342 364 N/A INTRINSIC
transmembrane domain 383 405 N/A INTRINSIC
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106566
AA Change: K380R

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000102176
Gene: ENSMUSG00000055960
AA Change: K380R

DomainStartEndE-ValueType
IG 41 148 7.24e-10 SMART
transmembrane domain 250 272 N/A INTRINSIC
transmembrane domain 304 326 N/A INTRINSIC
transmembrane domain 350 372 N/A INTRINSIC
transmembrane domain 391 413 N/A INTRINSIC
transmembrane domain 433 455 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000121737
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Cyp4a31 A C 4: 115,570,269 D224A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Skint4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01397:Skint4 APN 4 112120010 missense possibly damaging 0.86
IGL01654:Skint4 APN 4 112120057 missense probably damaging 0.99
IGL02040:Skint4 APN 4 112146482 splice site probably benign
IGL02328:Skint4 APN 4 112120058 missense possibly damaging 0.92
IGL02811:Skint4 APN 4 112087003 missense possibly damaging 0.86
IGL02965:Skint4 APN 4 112136021 missense probably benign 0.01
IGL03039:Skint4 APN 4 112124650 missense probably benign 0.20
IGL03060:Skint4 APN 4 112118235 missense probably benign 0.33
IGL03075:Skint4 APN 4 112087042 missense probably damaging 1.00
IGL03352:Skint4 APN 4 112165686 missense possibly damaging 0.96
PIT4378001:Skint4 UTSW 4 112087035 missense probably benign 0.01
R0483:Skint4 UTSW 4 112117939 splice site probably benign
R1175:Skint4 UTSW 4 112124596 missense probably benign 0.14
R1446:Skint4 UTSW 4 112118114 missense probably benign 0.11
R1641:Skint4 UTSW 4 112136043 missense possibly damaging 0.93
R1983:Skint4 UTSW 4 112146492 missense probably benign 0.00
R2168:Skint4 UTSW 4 112086986 critical splice acceptor site probably null
R2272:Skint4 UTSW 4 112119868 missense probably benign 0.01
R2287:Skint4 UTSW 4 112118205 missense possibly damaging 0.70
R3801:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3802:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R3804:Skint4 UTSW 4 112118181 missense probably damaging 0.98
R4009:Skint4 UTSW 4 112120109 missense possibly damaging 0.70
R4050:Skint4 UTSW 4 112124614 missense probably benign 0.01
R4564:Skint4 UTSW 4 112119869 missense probably damaging 0.99
R4581:Skint4 UTSW 4 112087042 missense probably damaging 1.00
R4587:Skint4 UTSW 4 112087024 missense probably damaging 0.99
R4674:Skint4 UTSW 4 112118233 missense probably damaging 1.00
R4723:Skint4 UTSW 4 112118236 missense possibly damaging 0.70
R4753:Skint4 UTSW 4 112146531 missense probably benign 0.00
R4775:Skint4 UTSW 4 112136064 missense probably damaging 0.97
R4832:Skint4 UTSW 4 112143766 missense possibly damaging 0.49
R5299:Skint4 UTSW 4 112136006 missense possibly damaging 0.59
R6118:Skint4 UTSW 4 112119822 splice site probably null
R6616:Skint4 UTSW 4 112118230 missense possibly damaging 0.70
R6698:Skint4 UTSW 4 112119899 missense probably damaging 1.00
R6752:Skint4 UTSW 4 112119863 missense possibly damaging 0.89
R7034:Skint4 UTSW 4 112158084 missense possibly damaging 0.53
R7102:Skint4 UTSW 4 112118101 missense probably damaging 1.00
R7602:Skint4 UTSW 4 112118271 missense possibly damaging 0.50
R8027:Skint4 UTSW 4 112157985 critical splice acceptor site probably null
R8147:Skint4 UTSW 4 112136021 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CAGCCTCTGATTTTGTGCTG -3'
(R):5'- CAATTCCAGAGACAAGCATTTAGG -3'

Sequencing Primer
(F):5'- CTTCTCTTAGTTTTGCAAATCGAGG -3'
(R):5'- CGTAATTGCAGATGCACAAG -3'
Posted On2018-05-24