Mutagenetix > Incidental Mutation

Incidental Mutation 'R6433:Itga10'

518628

Institutional Source

Beutler Lab

Gene Symbol

Itga10

Ensembl Gene

ENSMUSG00000090210

Gene Name

integrin, alpha 10

Synonyms

MMRRC Submission

044571-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.220) question?

Stock #

R6433 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

96645584-96664519 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 96658041 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000112393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029744] [ENSMUST00000119365] [ENSMUST00000137564]

AlphaFold

E9Q6R1

Predicted Effect

probably null
Transcript: ENSMUST00000029744

SMART Domains

Protein: ENSMUSP00000029744
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1123	1145	N/A	INTRINSIC
low complexity region	1153	1166	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000119365

SMART Domains

Protein: ENSMUSP00000112393
Gene: ENSMUSG00000090210

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
Int_alpha	37	93	9.03e-3	SMART
VWA	165	355	9.6e-43	SMART
Int_alpha	427	481	2.01e0	SMART
Int_alpha	482	539	5.14e-7	SMART
Int_alpha	545	600	5.34e-14	SMART
Int_alpha	607	652	8.75e0	SMART
transmembrane domain	1122	1144	N/A	INTRINSIC
low complexity region	1152	1165	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127607

Predicted Effect

probably benign
Transcript: ENSMUST00000137564

SMART Domains

Protein: ENSMUSP00000121011
Gene: ENSMUSG00000106447

Domain	Start	End	E-Value	Type
Pfam:PEX11	1	172	4.5e-57	PFAM
low complexity region	186	204	N/A	INTRINSIC
Int_alpha	222	278	9.03e-3	SMART
Blast:VWA	292	345	3e-7	BLAST

Meta Mutation Damage Score

0.9707

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.6%

Validation Efficiency

100% (56/56)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Integrins are integral transmembrane glycoproteins composed of noncovalently linked alpha and beta chains. They participate in cell adhesion as well as cell-surface mediated signalling. This gene encodes an integrin alpha chain and is expressed at high levels in chondrocytes, where it is transcriptionally regulated by AP-2epsilon and Ets-1. The protein encoded by this gene binds to collagen. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2014]
PHENOTYPE: Homozygous null mice display slightly shortened long bones and amild abnormalities in ephysiseal plate morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 54 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Afdn	T	A	17: 13,881,299	D1016E	probably damaging	Het
Aplnr	A	T	2: 85,136,673	Q14L	probably benign	Het
Aspm	T	C	1: 139,473,683	L1147S	probably damaging	Het
Atad2b	A	G	12: 4,952,642	T337A	possibly damaging	Het
Atrn	A	G	2: 131,023,027	E1358G	probably damaging	Het
Caml	C	A	13: 55,623,249	S53R	possibly damaging	Het
Cd180	T	G	13: 102,705,633	S396A	probably benign	Het
Cdhr2	A	G	13: 54,718,512	T344A	probably damaging	Het
Cyp4a31	A	C	4: 115,570,269	D224A	probably damaging	Het
Dhx36	T	C	3: 62,484,974	T544A	probably damaging	Het
Dnah14	A	G	1: 181,651,657	K1528E	probably damaging	Het
Dnpep	T	A	1: 75,315,378	K199N	probably benign	Het
Dsc2	C	T	18: 20,051,175		probably null	Het
Efl1	T	A	7: 82,674,568	D239E	probably damaging	Het
Elovl4	A	G	9: 83,785,178	V42A	possibly damaging	Het
Exoc3	T	C	13: 74,189,187	T432A	possibly damaging	Het
Fam98c	A	G	7: 29,156,128		probably null	Het
Fbln2	G	A	6: 91,233,272	G66D	probably damaging	Het
Fchsd1	G	A	18: 37,964,084	T410I	possibly damaging	Het
Flcn	T	C	11: 59,801,082	D247G	probably damaging	Het
Galnt16	T	C	12: 80,575,903	V127A	probably benign	Het
H2-Ob	A	T	17: 34,243,886		probably null	Het
Has2	G	A	15: 56,667,798	S507F	possibly damaging	Het
Ido2	T	A	8: 24,533,923	M300L	probably damaging	Het
Klra9	G	T	6: 130,179,032	Y253*	probably null	Het
Mfsd2a	A	G	4: 122,950,457	V299A	probably benign	Het
Mybpc1	T	C	10: 88,560,355	D210G	probably damaging	Het
Ndrg1	A	T	15: 66,933,872	M128K	probably damaging	Het
Obscn	T	A	11: 59,051,558	T5091S	probably benign	Het
Olfr137	A	G	17: 38,305,413	L16P	probably damaging	Het
Pex5	A	T	6: 124,413,613	M91K	possibly damaging	Het
Phlpp2	G	T	8: 109,934,685	A810S	probably benign	Het
Pla2g7	G	C	17: 43,599,126	A174P	probably damaging	Het
Plxna4	C	T	6: 32,215,678	V783M	probably damaging	Het
Poll	A	T	19: 45,553,604	M421K	probably benign	Het
Ppfia2	C	A	10: 106,913,698	S1148R	possibly damaging	Het
Prkg1	A	G	19: 30,781,346	F280S	probably benign	Het
Rdh10	G	A	1: 16,107,855	C117Y	probably damaging	Het
Rtl1	C	A	12: 109,595,196	A70S	unknown	Het
Scgb2b3	A	T	7: 31,359,067	L104I	probably benign	Het
Sh3tc1	T	C	5: 35,706,597	R749G	probably damaging	Het
Skint4	A	G	4: 112,146,510	K380R	probably benign	Het
Smtnl1	A	C	2: 84,818,368	S181A	probably benign	Het
Spata31d1b	T	C	13: 59,717,185	S716P	probably damaging	Het
Spc25	A	G	2: 69,206,102		probably benign	Het
Stab2	C	T	10: 86,901,567		probably null	Het
Timm22	T	C	11: 76,409,744	V114A	possibly damaging	Het
Timp4	A	G	6: 115,247,220	C163R	probably damaging	Het
Toporsl	T	A	4: 52,611,548	N480K	possibly damaging	Het
Tpo	T	C	12: 30,084,754	E735G	probably benign	Het
Trpm3	A	G	19: 22,901,305	D692G	probably damaging	Het
Ttn	T	C	2: 76,751,714	H22945R	probably damaging	Het
Vmn2r6	A	T	3: 64,547,380	Y499*	probably null	Het
Vwa1	G	A	4: 155,772,769	H191Y	probably benign	Het

Other mutations in Itga10

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01473:Itga10	APN	3	96647641	missense	probably damaging	0.96
IGL01694:Itga10	APN	3	96652517	missense	probably damaging	0.99
IGL01754:Itga10	APN	3	96656775	unclassified	probably benign
IGL02527:Itga10	APN	3	96655624	unclassified	probably benign
IGL02956:Itga10	APN	3	96655113	missense	possibly damaging	0.46
IGL03371:Itga10	APN	3	96654788	missense	possibly damaging	0.84
IGL03055:Itga10	UTSW	3	96650520	missense	probably damaging	0.99
PIT4515001:Itga10	UTSW	3	96662632	missense	probably damaging	0.99
R0153:Itga10	UTSW	3	96653700	missense	probably benign	0.00
R0308:Itga10	UTSW	3	96651464	missense	probably damaging	1.00
R0331:Itga10	UTSW	3	96652483	missense	probably damaging	1.00
R0413:Itga10	UTSW	3	96649059	missense	probably damaging	1.00
R0437:Itga10	UTSW	3	96649137	missense	probably damaging	1.00
R0511:Itga10	UTSW	3	96658174	missense	probably damaging	1.00
R0630:Itga10	UTSW	3	96656299	unclassified	probably benign
R0844:Itga10	UTSW	3	96651738	splice site	probably benign
R0849:Itga10	UTSW	3	96652530	missense	possibly damaging	0.67
R0894:Itga10	UTSW	3	96653660	missense	possibly damaging	0.69
R0919:Itga10	UTSW	3	96651738	splice site	probably benign
R1027:Itga10	UTSW	3	96651738	splice site	probably benign
R1341:Itga10	UTSW	3	96652495	missense	probably damaging	1.00
R1350:Itga10	UTSW	3	96657477	missense	probably benign	0.01
R1370:Itga10	UTSW	3	96651738	splice site	probably benign
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1467:Itga10	UTSW	3	96652229	nonsense	probably null
R1589:Itga10	UTSW	3	96651738	splice site	probably benign
R1590:Itga10	UTSW	3	96651738	splice site	probably benign
R1601:Itga10	UTSW	3	96653658	missense	possibly damaging	0.82
R1659:Itga10	UTSW	3	96662977	missense	probably damaging	0.96
R1665:Itga10	UTSW	3	96651738	splice site	probably benign
R1667:Itga10	UTSW	3	96651738	splice site	probably benign
R1686:Itga10	UTSW	3	96651825	missense	probably damaging	0.97
R1972:Itga10	UTSW	3	96651738	splice site	probably benign
R1976:Itga10	UTSW	3	96651738	splice site	probably benign
R2020:Itga10	UTSW	3	96652490	missense	probably damaging	1.00
R2040:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96651738	splice site	probably benign
R2044:Itga10	UTSW	3	96657690	missense	probably benign
R2045:Itga10	UTSW	3	96651738	splice site	probably benign
R2060:Itga10	UTSW	3	96654998	nonsense	probably null
R2146:Itga10	UTSW	3	96651492	missense	possibly damaging	0.59
R2146:Itga10	UTSW	3	96653723	missense	probably damaging	1.00
R2170:Itga10	UTSW	3	96650457	missense	probably damaging	1.00
R2893:Itga10	UTSW	3	96655100	missense	probably benign	0.11
R2926:Itga10	UTSW	3	96652849	missense	probably damaging	1.00
R3622:Itga10	UTSW	3	96651738	splice site	probably benign
R3623:Itga10	UTSW	3	96651738	splice site	probably benign
R4416:Itga10	UTSW	3	96658246	missense	possibly damaging	0.58
R4633:Itga10	UTSW	3	96647704	missense	possibly damaging	0.92
R5074:Itga10	UTSW	3	96652211	nonsense	probably null
R5095:Itga10	UTSW	3	96648164	missense	probably benign	0.21
R5495:Itga10	UTSW	3	96647371	missense	possibly damaging	0.92
R5813:Itga10	UTSW	3	96652585	missense	probably benign	0.38
R6114:Itga10	UTSW	3	96649035	missense	probably damaging	1.00
R6172:Itga10	UTSW	3	96647437	missense	probably benign	0.18
R6275:Itga10	UTSW	3	96658185	missense	probably benign	0.36
R6298:Itga10	UTSW	3	96656762	missense	probably benign	0.00
R6841:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R6909:Itga10	UTSW	3	96662599	missense	probably benign	0.00
R6927:Itga10	UTSW	3	96656714	missense	probably damaging	1.00
R7124:Itga10	UTSW	3	96651765	missense	probably damaging	0.96
R7310:Itga10	UTSW	3	96648159	missense	probably damaging	1.00
R7387:Itga10	UTSW	3	96652778	missense	probably benign	0.11
R7464:Itga10	UTSW	3	96648155	missense	probably damaging	1.00
R7624:Itga10	UTSW	3	96652953	missense	probably benign
R7638:Itga10	UTSW	3	96657391	splice site	probably null
R7639:Itga10	UTSW	3	96649582	missense	probably benign	0.36
R7893:Itga10	UTSW	3	96649612	missense	probably damaging	1.00
R8297:Itga10	UTSW	3	96654800	missense	probably damaging	1.00
R8753:Itga10	UTSW	3	96651155	missense	probably damaging	1.00
R9526:Itga10	UTSW	3	96656957	missense	probably damaging	1.00
X0064:Itga10	UTSW	3	96652936	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- GGGACCACTCTTATATGTAGCTTG -3'
(R):5'- TCAGCAGCCTGACAGAGATC -3'

Sequencing Primer
(F):5'- ACCACTCTTATATGTAGCTTGGGAGG -3'
(R):5'- TTTGCCAGCAGTCCAAGGTG -3'

Posted On

2018-05-24