Incidental Mutation 'R6433:Cyp4a31'
ID518631
Institutional Source Beutler Lab
Gene Symbol Cyp4a31
Ensembl Gene ENSMUSG00000028712
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R6433 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115563649-115579015 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 115570269 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 224 (D224A)
Ref Sequence ENSEMBL: ENSMUSP00000030480 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030480] [ENSMUST00000030486] [ENSMUST00000126645] [ENSMUST00000141033]
Predicted Effect probably damaging
Transcript: ENSMUST00000030480
AA Change: D224A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000030480
Gene: ENSMUSG00000028712
AA Change: D224A

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:p450 51 415 3.6e-97 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000030486
AA Change: D239A

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030486
Gene: ENSMUSG00000028712
AA Change: D239A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 504 2.6e-134 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000126645
AA Change: D238A

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000117129
Gene: ENSMUSG00000028712
AA Change: D238A

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 340 4.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141033
SMART Domains Protein: ENSMUSP00000115628
Gene: ENSMUSG00000028712

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 51 155 2.9e-17 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 100% (56/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afdn T A 17: 13,881,299 D1016E probably damaging Het
Aplnr A T 2: 85,136,673 Q14L probably benign Het
Aspm T C 1: 139,473,683 L1147S probably damaging Het
Atad2b A G 12: 4,952,642 T337A possibly damaging Het
Atrn A G 2: 131,023,027 E1358G probably damaging Het
Caml C A 13: 55,623,249 S53R possibly damaging Het
Cd180 T G 13: 102,705,633 S396A probably benign Het
Cdhr2 A G 13: 54,718,512 T344A probably damaging Het
Dhx36 T C 3: 62,484,974 T544A probably damaging Het
Dnah14 A G 1: 181,651,657 K1528E probably damaging Het
Dnpep T A 1: 75,315,378 K199N probably benign Het
Dsc2 C T 18: 20,051,175 probably null Het
Efl1 T A 7: 82,674,568 D239E probably damaging Het
Elovl4 A G 9: 83,785,178 V42A possibly damaging Het
Exoc3 T C 13: 74,189,187 T432A possibly damaging Het
Fam98c A G 7: 29,156,128 probably null Het
Fbln2 G A 6: 91,233,272 G66D probably damaging Het
Fchsd1 G A 18: 37,964,084 T410I possibly damaging Het
Flcn T C 11: 59,801,082 D247G probably damaging Het
Galnt16 T C 12: 80,575,903 V127A probably benign Het
H2-Ob A T 17: 34,243,886 probably null Het
Has2 G A 15: 56,667,798 S507F possibly damaging Het
Ido2 T A 8: 24,533,923 M300L probably damaging Het
Itga10 T C 3: 96,658,041 probably null Het
Klra9 G T 6: 130,179,032 Y253* probably null Het
Mfsd2a A G 4: 122,950,457 V299A probably benign Het
Mybpc1 T C 10: 88,560,355 D210G probably damaging Het
Ndrg1 A T 15: 66,933,872 M128K probably damaging Het
Obscn T A 11: 59,051,558 T5091S probably benign Het
Olfr137 A G 17: 38,305,413 L16P probably damaging Het
Pex5 A T 6: 124,413,613 M91K possibly damaging Het
Phlpp2 G T 8: 109,934,685 A810S probably benign Het
Pla2g7 G C 17: 43,599,126 A174P probably damaging Het
Plxna4 C T 6: 32,215,678 V783M probably damaging Het
Poll A T 19: 45,553,604 M421K probably benign Het
Ppfia2 C A 10: 106,913,698 S1148R possibly damaging Het
Prkg1 A G 19: 30,781,346 F280S probably benign Het
Rdh10 G A 1: 16,107,855 C117Y probably damaging Het
Rtl1 C A 12: 109,595,196 A70S unknown Het
Scgb2b3 A T 7: 31,359,067 L104I probably benign Het
Sh3tc1 T C 5: 35,706,597 R749G probably damaging Het
Skint4 A G 4: 112,146,510 K380R probably benign Het
Smtnl1 A C 2: 84,818,368 S181A probably benign Het
Spata31d1b T C 13: 59,717,185 S716P probably damaging Het
Spc25 A G 2: 69,206,102 probably benign Het
Stab2 C T 10: 86,901,567 probably null Het
Timm22 T C 11: 76,409,744 V114A possibly damaging Het
Timp4 A G 6: 115,247,220 C163R probably damaging Het
Toporsl T A 4: 52,611,548 N480K possibly damaging Het
Tpo T C 12: 30,084,754 E735G probably benign Het
Trpm3 A G 19: 22,901,305 D692G probably damaging Het
Ttn T C 2: 76,751,714 H22945R probably damaging Het
Vmn2r6 A T 3: 64,547,380 Y499* probably null Het
Vwa1 G A 4: 155,772,769 H191Y probably benign Het
Other mutations in Cyp4a31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Cyp4a31 APN 4 115574974 unclassified probably benign
IGL01682:Cyp4a31 APN 4 115578031 missense probably damaging 0.97
IGL02112:Cyp4a31 APN 4 115570983 missense probably damaging 1.00
IGL02292:Cyp4a31 APN 4 115566501 missense probably damaging 0.98
IGL02343:Cyp4a31 APN 4 115563829 missense probably damaging 1.00
IGL02508:Cyp4a31 APN 4 115571064 missense probably damaging 1.00
IGL03094:Cyp4a31 APN 4 115578108 utr 3 prime probably benign
IGL03493:Cyp4a31 APN 4 115570755 splice site probably null
R0400:Cyp4a31 UTSW 4 115563718 start codon destroyed probably null 1.00
R1263:Cyp4a31 UTSW 4 115574711 missense probably benign 0.01
R1508:Cyp4a31 UTSW 4 115565053 missense possibly damaging 0.53
R1523:Cyp4a31 UTSW 4 115569754 missense probably benign 0.23
R1822:Cyp4a31 UTSW 4 115566613 splice site probably null
R1832:Cyp4a31 UTSW 4 115569731 missense probably benign
R1872:Cyp4a31 UTSW 4 115574736 missense probably damaging 0.99
R2351:Cyp4a31 UTSW 4 115571313 missense possibly damaging 0.95
R2426:Cyp4a31 UTSW 4 115571016 missense probably damaging 0.98
R2993:Cyp4a31 UTSW 4 115569820 missense probably benign 0.03
R3743:Cyp4a31 UTSW 4 115566519 missense possibly damaging 0.95
R3812:Cyp4a31 UTSW 4 115566509 missense probably benign
R3963:Cyp4a31 UTSW 4 115574772 unclassified probably benign
R4211:Cyp4a31 UTSW 4 115565013 missense probably benign 0.01
R4814:Cyp4a31 UTSW 4 115570269 missense probably damaging 1.00
R6245:Cyp4a31 UTSW 4 115571348 missense possibly damaging 0.91
R6255:Cyp4a31 UTSW 4 115574920 missense possibly damaging 0.82
R6330:Cyp4a31 UTSW 4 115563877 missense probably damaging 0.99
R6602:Cyp4a31 UTSW 4 115569707 critical splice acceptor site probably null
R6844:Cyp4a31 UTSW 4 115563792 missense probably null 0.00
R7154:Cyp4a31 UTSW 4 115574766 critical splice donor site probably null
R7300:Cyp4a31 UTSW 4 115570271 missense probably benign 0.03
X0020:Cyp4a31 UTSW 4 115565109 missense probably benign 0.06
X0021:Cyp4a31 UTSW 4 115577961 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GATGCCTAGTCACTCATGCC -3'
(R):5'- TCCTAAAGGGATGTGCATTGAAG -3'

Sequencing Primer
(F):5'- AGACAGAGTTAGTGTGTTTCTCAACG -3'
(R):5'- AAGGGTCTGGATGTGCCTCAG -3'
Posted On2018-05-24