Incidental Mutation 'R6753:Comt'
ID 530927
Institutional Source Beutler Lab
Gene Symbol Comt
Ensembl Gene ENSMUSG00000000326
Gene Name catechol-O-methyltransferase
Synonyms D330014B15Rik, Comt1, D16Wsu103e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 16
Chromosomal Location 18406886-18426852 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 18408021 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 205 (K205R)
Ref Sequence ENSEMBL: ENSMUSP00000130077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000335] [ENSMUST00000090103] [ENSMUST00000115609] [ENSMUST00000115610] [ENSMUST00000115612] [ENSMUST00000115613] [ENSMUST00000115614] [ENSMUST00000147720] [ENSMUST00000150253] [ENSMUST00000165430] [ENSMUST00000232025] [ENSMUST00000232241]
AlphaFold O88587
Predicted Effect probably benign
Transcript: ENSMUST00000000335
AA Change: K205R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000000335
Gene: ENSMUSG00000000326
AA Change: K205R

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000090103
SMART Domains Protein: ENSMUSP00000087562
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115609
AA Change: K205R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000111272
Gene: ENSMUSG00000000326
AA Change: K205R

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 63 224 3.5e-24 PFAM
Pfam:Methyltransf_26 102 224 3.3e-9 PFAM
Pfam:Methyltransf_24 106 214 1.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115610
SMART Domains Protein: ENSMUSP00000111273
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
low complexity region 77 93 N/A INTRINSIC
low complexity region 144 163 N/A INTRINSIC
ARM 327 367 4.48e-7 SMART
ARM 370 411 3.31e-10 SMART
Blast:ARM 412 469 1e-20 BLAST
ARM 472 518 2.1e1 SMART
low complexity region 555 563 N/A INTRINSIC
ARM 582 623 9.55e1 SMART
ARM 629 669 4.05e-5 SMART
ARM 720 762 3.03e0 SMART
low complexity region 857 875 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115612
SMART Domains Protein: ENSMUSP00000111275
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115613
SMART Domains Protein: ENSMUSP00000111276
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
ARM 652 693 9.55e1 SMART
ARM 699 739 4.05e-5 SMART
ARM 790 832 3.03e0 SMART
low complexity region 927 945 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115614
SMART Domains Protein: ENSMUSP00000111278
Gene: ENSMUSG00000000325

DomainStartEndE-ValueType
coiled coil region 11 46 N/A INTRINSIC
low complexity region 89 99 N/A INTRINSIC
low complexity region 117 138 N/A INTRINSIC
low complexity region 141 157 N/A INTRINSIC
low complexity region 208 227 N/A INTRINSIC
ARM 391 431 4.48e-7 SMART
ARM 434 475 3.31e-10 SMART
Blast:ARM 476 533 2e-20 BLAST
ARM 536 582 2.1e1 SMART
low complexity region 619 627 N/A INTRINSIC
ARM 646 687 9.55e1 SMART
ARM 693 733 4.05e-5 SMART
ARM 784 826 3.03e0 SMART
low complexity region 921 939 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000147720
SMART Domains Protein: ENSMUSP00000121810
Gene: ENSMUSG00000000326

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 62 171 4.1e-18 PFAM
Pfam:Methyltransf_24 106 171 4.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150253
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150484
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152132
Predicted Effect probably benign
Transcript: ENSMUST00000165430
AA Change: K205R

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000130077
Gene: ENSMUSG00000000326
AA Change: K205R

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
Pfam:Methyltransf_3 57 221 1.1e-22 PFAM
Pfam:Methyltransf_24 106 214 6.2e-14 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000232025
Predicted Effect probably benign
Transcript: ENSMUST00000232241
Meta Mutation Damage Score 0.2892 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Catechol-O-methyltransferase catalyzes the transfer of a methyl group from S-adenosylmethionine to catecholamines, including the neurotransmitters dopamine, epinephrine, and norepinephrine. This O-methylation results in one of the major degradative pathways of the catecholamine transmitters. In addition to its role in the metabolism of endogenous substances, COMT is important in the metabolism of catechol drugs used in the treatment of hypertension, asthma, and Parkinson disease. COMT is found in two forms in tissues, a soluble form (S-COMT) and a membrane-bound form (MB-COMT). The differences between S-COMT and MB-COMT reside within the N-termini. Several transcript variants are formed through the use of alternative translation initiation sites and promoters. [provided by RefSeq, Sep 2008]
PHENOTYPE: Mice homozygous for disruption of this gene are viable, fertile, and show no gross or histological abnormalities. However dopamine levels in the frontal cortex of males are increased. Also, males show increased aggression and females show increased anxiety. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 120,010,151 P1083S probably benign Het
Abcb5 T A 12: 118,944,906 N101I possibly damaging Het
Adrb2 A G 18: 62,179,553 V67A possibly damaging Het
Agk T A 6: 40,368,570 probably null Het
Akap10 A T 11: 61,886,777 M586K probably damaging Het
Akt3 A T 1: 177,050,190 Y337* probably null Het
Armc1 A G 3: 19,144,398 F133L possibly damaging Het
Bank1 T C 3: 136,093,308 E424G probably damaging Het
Cacna1a A G 8: 84,580,205 E1363G probably damaging Het
Cacna1d C A 14: 30,042,786 A2076S probably damaging Het
Ccdc73 T A 2: 104,991,524 L606* probably null Het
Ccdc8 C T 7: 16,996,637 Q684* probably null Het
Ces1b T A 8: 93,067,020 K314* probably null Het
Ces1e T A 8: 93,215,128 N238I probably damaging Het
Chd4 A G 6: 125,114,300 N1238S probably benign Het
Cmtr2 T A 8: 110,222,979 D640E probably damaging Het
Col7a1 C T 9: 108,958,128 T559I unknown Het
Dbp A T 7: 45,708,404 E232V probably damaging Het
Dcbld2 A G 16: 58,456,130 T470A possibly damaging Het
Eml6 T A 11: 29,754,987 D1519V probably damaging Het
Evpl T A 11: 116,237,906 H31L possibly damaging Het
Exoc1 T A 5: 76,563,339 I86N probably damaging Het
Fat3 C T 9: 15,915,061 E4532K possibly damaging Het
Fgfr3 T C 5: 33,732,159 S301P probably benign Het
Gas2l1 C T 11: 5,064,254 V69I probably damaging Het
Gm2042 T A 12: 87,958,084 I107K probably damaging Het
Gucy1b1 T C 3: 82,039,747 D385G probably null Het
Ints1 T A 5: 139,765,175 E824D probably damaging Het
Itfg1 T C 8: 85,835,078 D142G probably benign Het
Jaml A G 9: 45,107,379 N359D probably benign Het
Kcnh7 T A 2: 62,850,377 I289L probably benign Het
Klf12 G A 14: 100,109,776 Q40* probably null Het
Mcm4 A C 16: 15,629,362 N579K possibly damaging Het
Mfsd2b A T 12: 4,867,358 F179I possibly damaging Het
Mmp11 C T 10: 75,928,374 V86M probably damaging Het
Mogs T C 6: 83,115,882 V101A probably damaging Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Olfr987 C A 2: 85,331,798 M33I probably benign Het
Otog A C 7: 46,249,071 E204D probably benign Het
Parp8 G A 13: 116,895,115 H354Y possibly damaging Het
Pcnx C A 12: 81,964,480 D1238E probably damaging Het
Pi4ka A G 16: 17,376,982 L184P possibly damaging Het
Pkd1l3 C T 8: 109,624,449 T642I probably damaging Het
Pkhd1l1 G A 15: 44,589,663 E3995K probably benign Het
Prdm9 A T 17: 15,544,956 Y521N probably benign Het
Prex2 A G 1: 11,184,456 S1105G probably damaging Het
Prss35 T A 9: 86,756,100 F308I probably damaging Het
Rab22a C T 2: 173,701,055 A167V probably benign Het
Rims2 A G 15: 39,566,973 Q871R possibly damaging Het
Rorb A T 19: 18,957,247 M253K probably benign Het
Ryr3 T C 2: 112,652,610 D4269G probably damaging Het
Snx11 T C 11: 96,769,906 probably benign Het
Son A G 16: 91,657,188 Q941R probably damaging Het
Sptbn2 G T 19: 4,747,785 R1880L probably benign Het
Sun1 G A 5: 139,215,259 probably null Het
Tprn A G 2: 25,264,038 R451G probably benign Het
Trbv30 T A 6: 41,281,377 M1K probably null Het
Ttn C A 2: 76,738,221 G25697W probably damaging Het
Ubb T G 11: 62,551,527 probably null Het
Unc13b C T 4: 43,239,331 R1038C probably damaging Het
Usp7 T C 16: 8,696,911 M687V probably benign Het
Zfp160 G A 17: 21,020,734 M21I probably benign Het
Zfp868 T C 8: 69,612,096 N196S probably benign Het
Zufsp A T 10: 33,928,029 I483N probably damaging Het
Other mutations in Comt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02363:Comt APN 16 18411131 missense probably benign 0.21
IGL02568:Comt APN 16 18411704 missense probably damaging 0.99
IGL03286:Comt APN 16 18411740 missense probably damaging 1.00
R0845:Comt UTSW 16 18407961 missense probably damaging 1.00
R1318:Comt UTSW 16 18407891 missense probably damaging 1.00
R1541:Comt UTSW 16 18411815 missense probably benign 0.20
R4496:Comt UTSW 16 18411687 splice site probably null
R5619:Comt UTSW 16 18411719 missense probably damaging 1.00
R7286:Comt UTSW 16 18410690 missense probably damaging 1.00
R8061:Comt UTSW 16 18411290 missense probably benign 0.00
R8419:Comt UTSW 16 18411887 nonsense probably null
R8872:Comt UTSW 16 18426489 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TGTGTCATCGTGCAGAAGGG -3'
(R):5'- TCACTGTGTGGCCTACATGC -3'

Sequencing Primer
(F):5'- AAGCTCATCAGGCTGAGTGGTC -3'
(R):5'- TACATGCTCCTCTAGGGCTGG -3'
Posted On 2018-08-01