Mutagenetix > Incidental Mutations

Incidental Mutation 'R6753:Pcnx'

530916

Institutional Source

Beutler Lab

Gene Symbol

Pcnx

Ensembl Gene

ENSMUSG00000021140

Gene Name

pecanex homolog

Synonyms

3526401J03Rik, 2900024E21Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6753 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

81860023-82000924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 81964480 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1238 (D1238E)

Ref Sequence

ENSEMBL: ENSMUSP00000152104 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021567] [ENSMUST00000221721] [ENSMUST00000222005]

Predicted Effect

probably benign
Transcript: ENSMUST00000021567
AA Change: D1244E

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000021567
Gene: ENSMUSG00000021140
AA Change: D1244E

Domain	Start	End	E-Value	Type
transmembrane domain	28	50	N/A	INTRINSIC
transmembrane domain	52	74	N/A	INTRINSIC
low complexity region	369	390	N/A	INTRINSIC
low complexity region	407	422	N/A	INTRINSIC
low complexity region	509	525	N/A	INTRINSIC
low complexity region	616	638	N/A	INTRINSIC
low complexity region	672	692	N/A	INTRINSIC
low complexity region	764	783	N/A	INTRINSIC
low complexity region	817	835	N/A	INTRINSIC
low complexity region	842	853	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
transmembrane domain	1006	1028	N/A	INTRINSIC
transmembrane domain	1035	1052	N/A	INTRINSIC
transmembrane domain	1070	1092	N/A	INTRINSIC
transmembrane domain	1113	1135	N/A	INTRINSIC
transmembrane domain	1163	1185	N/A	INTRINSIC
transmembrane domain	1197	1216	N/A	INTRINSIC
transmembrane domain	1269	1291	N/A	INTRINSIC
transmembrane domain	1298	1315	N/A	INTRINSIC
Pfam:Pecanex_C	1785	2011	1.6e-118	PFAM
low complexity region	2125	2140	N/A	INTRINSIC
low complexity region	2195	2202	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000221675
AA Change: D605E

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)

Predicted Effect

probably damaging
Transcript: ENSMUST00000221721
AA Change: D1238E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

probably benign
Transcript: ENSMUST00000222005

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222828

Meta Mutation Damage Score

0.0699

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.3%
20x: 95.1%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an evolutionarily conserved transmembrane protein similar to the pecanex protein in Drosophila. The fly protein is a component of the Notch signaling pathway, which functions in several developmental processes. [provided by RefSeq, Jul 2016]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Aatk	G	A	11: 120,010,151	P1083S	probably benign	Het
Abcb5	T	A	12: 118,944,906	N101I	possibly damaging	Het
Adrb2	A	G	18: 62,179,553	V67A	possibly damaging	Het
Agk	T	A	6: 40,368,570		probably null	Het
Akap10	A	T	11: 61,886,777	M586K	probably damaging	Het
Akt3	A	T	1: 177,050,190	Y337*	probably null	Het
Armc1	A	G	3: 19,144,398	F133L	possibly damaging	Het
Bank1	T	C	3: 136,093,308	E424G	probably damaging	Het
Cacna1a	A	G	8: 84,580,205	E1363G	probably damaging	Het
Cacna1d	C	A	14: 30,042,786	A2076S	probably damaging	Het
Ccdc73	T	A	2: 104,991,524	L606*	probably null	Het
Ccdc8	C	T	7: 16,996,637	Q684*	probably null	Het
Ces1b	T	A	8: 93,067,020	K314*	probably null	Het
Ces1e	T	A	8: 93,215,128	N238I	probably damaging	Het
Chd4	A	G	6: 125,114,300	N1238S	probably benign	Het
Cmtr2	T	A	8: 110,222,979	D640E	probably damaging	Het
Col7a1	C	T	9: 108,958,128	T559I	unknown	Het
Comt	T	C	16: 18,408,021	K205R	probably benign	Het
Dbp	A	T	7: 45,708,404	E232V	probably damaging	Het
Dcbld2	A	G	16: 58,456,130	T470A	possibly damaging	Het
Eml6	T	A	11: 29,754,987	D1519V	probably damaging	Het
Evpl	T	A	11: 116,237,906	H31L	possibly damaging	Het
Exoc1	T	A	5: 76,563,339	I86N	probably damaging	Het
Fat3	C	T	9: 15,915,061	E4532K	possibly damaging	Het
Fgfr3	T	C	5: 33,732,159	S301P	probably benign	Het
Gas2l1	C	T	11: 5,064,254	V69I	probably damaging	Het
Gm2042	T	A	12: 87,958,084	I107K	probably damaging	Het
Gucy1b1	T	C	3: 82,039,747	D385G	probably null	Het
Ints1	T	A	5: 139,765,175	E824D	probably damaging	Het
Itfg1	T	C	8: 85,835,078	D142G	probably benign	Het
Jaml	A	G	9: 45,107,379	N359D	probably benign	Het
Kcnh7	T	A	2: 62,850,377	I289L	probably benign	Het
Klf12	G	A	14: 100,109,776	Q40*	probably null	Het
Mcm4	A	C	16: 15,629,362	N579K	possibly damaging	Het
Mfsd2b	A	T	12: 4,867,358	F179I	possibly damaging	Het
Mmp11	C	T	10: 75,928,374	V86M	probably damaging	Het
Mogs	T	C	6: 83,115,882	V101A	probably damaging	Het
Narf	T	A	11: 121,242,626	H84Q	probably benign	Het
Olfr987	C	A	2: 85,331,798	M33I	probably benign	Het
Otog	A	C	7: 46,249,071	E204D	probably benign	Het
Parp8	G	A	13: 116,895,115	H354Y	possibly damaging	Het
Pi4ka	A	G	16: 17,376,982	L184P	possibly damaging	Het
Pkd1l3	C	T	8: 109,624,449	T642I	probably damaging	Het
Pkhd1l1	G	A	15: 44,589,663	E3995K	probably benign	Het
Prdm9	A	T	17: 15,544,956	Y521N	probably benign	Het
Prex2	A	G	1: 11,184,456	S1105G	probably damaging	Het
Prss35	T	A	9: 86,756,100	F308I	probably damaging	Het
Rab22a	C	T	2: 173,701,055	A167V	probably benign	Het
Rims2	A	G	15: 39,566,973	Q871R	possibly damaging	Het
Rorb	A	T	19: 18,957,247	M253K	probably benign	Het
Ryr3	T	C	2: 112,652,610	D4269G	probably damaging	Het
Snx11	T	C	11: 96,769,906		probably benign	Het
Son	A	G	16: 91,657,188	Q941R	probably damaging	Het
Sptbn2	G	T	19: 4,747,785	R1880L	probably benign	Het
Sun1	G	A	5: 139,215,259		probably null	Het
Tprn	A	G	2: 25,264,038	R451G	probably benign	Het
Trbv30	T	A	6: 41,281,377	M1K	probably null	Het
Ttn	C	A	2: 76,738,221	G25697W	probably damaging	Het
Ubb	T	G	11: 62,551,527		probably null	Het
Unc13b	C	T	4: 43,239,331	R1038C	probably damaging	Het
Usp7	T	C	16: 8,696,911	M687V	probably benign	Het
Zfp160	G	A	17: 21,020,734	M21I	probably benign	Het
Zfp868	T	C	8: 69,612,096	N196S	probably benign	Het
Zufsp	A	T	10: 33,928,029	I483N	probably damaging	Het

Other mutations in Pcnx

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Pcnx	APN	12	81895101	missense	probably damaging	0.98
IGL00561:Pcnx	APN	12	81996053	missense	probably damaging	1.00
IGL01066:Pcnx	APN	12	81992021	missense	possibly damaging	0.87
IGL01069:Pcnx	APN	12	81918144	missense	probably benign	0.27
IGL01082:Pcnx	APN	12	81990598	missense	possibly damaging	0.62
IGL01087:Pcnx	APN	12	81995339	splice site	probably benign
IGL01145:Pcnx	APN	12	81992035	missense	probably damaging	0.99
IGL01412:Pcnx	APN	12	81906465	missense	probably damaging	1.00
IGL01477:Pcnx	APN	12	81973241	missense	probably damaging	0.98
IGL01639:Pcnx	APN	12	81950320	critical splice donor site	probably null
IGL01815:Pcnx	APN	12	81990551	missense	probably damaging	1.00
IGL01870:Pcnx	APN	12	81975893	missense	probably benign	0.01
IGL01902:Pcnx	APN	12	81979094	missense	probably damaging	1.00
IGL01935:Pcnx	APN	12	81917816	missense	probably benign	0.00
IGL02141:Pcnx	APN	12	81860382	missense	possibly damaging	0.86
IGL02179:Pcnx	APN	12	81933719	intron	probably benign
IGL02197:Pcnx	APN	12	81919104	missense	probably benign	0.01
IGL02197:Pcnx	APN	12	81993151	missense	possibly damaging	0.85
IGL02238:Pcnx	APN	12	81917914	missense	probably damaging	1.00
IGL02430:Pcnx	APN	12	81919322	missense	possibly damaging	0.89
IGL02590:Pcnx	APN	12	81994978	missense	probably damaging	1.00
IGL02992:Pcnx	APN	12	81964120	missense	probably damaging	1.00
IGL03304:Pcnx	APN	12	81982029	missense	probably damaging	1.00
ihop	UTSW	12	81971376	missense	probably benign	0.09
PIT4515001:Pcnx	UTSW	12	81991787	missense
R0086:Pcnx	UTSW	12	81992058	unclassified	probably benign
R0114:Pcnx	UTSW	12	81996095	missense	possibly damaging	0.95
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0240:Pcnx	UTSW	12	81947018	missense	possibly damaging	0.67
R0376:Pcnx	UTSW	12	81974579	splice site	probably benign
R0377:Pcnx	UTSW	12	81974579	splice site	probably benign
R0416:Pcnx	UTSW	12	81974466	missense	probably benign	0.09
R0514:Pcnx	UTSW	12	81995110	missense	probably benign	0.21
R0563:Pcnx	UTSW	12	81917944	missense	probably damaging	1.00
R0569:Pcnx	UTSW	12	81992030	missense	probably benign	0.08
R0626:Pcnx	UTSW	12	81983676	missense	possibly damaging	0.82
R0972:Pcnx	UTSW	12	81913412	missense	probably damaging	1.00
R1205:Pcnx	UTSW	12	81956243	missense	probably damaging	1.00
R1455:Pcnx	UTSW	12	81973234	missense	probably damaging	1.00
R1514:Pcnx	UTSW	12	81918798	missense	probably damaging	1.00
R1731:Pcnx	UTSW	12	81990704	missense	probably damaging	1.00
R1758:Pcnx	UTSW	12	81983484	missense	probably benign	0.27
R1774:Pcnx	UTSW	12	81975320	missense	probably damaging	1.00
R1817:Pcnx	UTSW	12	81918642	missense	probably benign
R1843:Pcnx	UTSW	12	81980935	missense	probably damaging	1.00
R1862:Pcnx	UTSW	12	81918732	missense	probably damaging	1.00
R2042:Pcnx	UTSW	12	81918293	missense	probably damaging	1.00
R2054:Pcnx	UTSW	12	81933674	missense	probably benign	0.02
R2243:Pcnx	UTSW	12	81918705	missense	probably damaging	1.00
R2272:Pcnx	UTSW	12	81995314	missense	probably benign	0.26
R2360:Pcnx	UTSW	12	81950186	missense	probably damaging	0.99
R2926:Pcnx	UTSW	12	81994995	missense	probably damaging	1.00
R3607:Pcnx	UTSW	12	81928292	missense	probably damaging	1.00
R3781:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3782:Pcnx	UTSW	12	81996118	missense	probably benign	0.00
R3806:Pcnx	UTSW	12	81950137	missense	possibly damaging	0.84
R3926:Pcnx	UTSW	12	81958731	missense	probably damaging	1.00
R4019:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4020:Pcnx	UTSW	12	81918244	missense	probably damaging	1.00
R4683:Pcnx	UTSW	12	81986672	missense	probably benign	0.01
R4703:Pcnx	UTSW	12	81895164	missense	probably benign	0.01
R4732:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4733:Pcnx	UTSW	12	81995751	missense	probably benign	0.01
R4755:Pcnx	UTSW	12	81950294	missense	probably damaging	1.00
R4792:Pcnx	UTSW	12	81919151	missense	probably damaging	1.00
R4897:Pcnx	UTSW	12	81918165	missense	probably damaging	1.00
R4915:Pcnx	UTSW	12	81974495	missense	probably benign	0.10
R4934:Pcnx	UTSW	12	81991825	missense	possibly damaging	0.76
R4940:Pcnx	UTSW	12	81917793	missense	possibly damaging	0.60
R5079:Pcnx	UTSW	12	81979089	nonsense	probably null
R5087:Pcnx	UTSW	12	81994939	missense	probably damaging	1.00
R5284:Pcnx	UTSW	12	81919029	missense	probably benign	0.02
R5287:Pcnx	UTSW	12	81982051	missense	probably damaging	1.00
R5436:Pcnx	UTSW	12	81860406	missense	probably damaging	1.00
R5505:Pcnx	UTSW	12	81950153	missense	probably damaging	1.00
R5538:Pcnx	UTSW	12	81860409	missense	probably damaging	1.00
R5632:Pcnx	UTSW	12	81917730	missense	probably damaging	1.00
R5642:Pcnx	UTSW	12	81895029	missense	possibly damaging	0.45
R5841:Pcnx	UTSW	12	81918655	missense	possibly damaging	0.62
R6275:Pcnx	UTSW	12	81918607	missense	probably benign	0.34
R6508:Pcnx	UTSW	12	81912705	missense	probably damaging	0.98
R6532:Pcnx	UTSW	12	81980964	missense	probably damaging	1.00
R6634:Pcnx	UTSW	12	81917882	nonsense	probably null
R6776:Pcnx	UTSW	12	81962722	missense	possibly damaging	0.81
R6778:Pcnx	UTSW	12	81918871	missense	probably damaging	1.00
R6890:Pcnx	UTSW	12	81971376	missense	probably benign	0.09
R6894:Pcnx	UTSW	12	81987973	missense	probably damaging	1.00
R6927:Pcnx	UTSW	12	81917812	missense	probably benign	0.37
R7173:Pcnx	UTSW	12	81953003	intron	probably null
R7196:Pcnx	UTSW	12	81995538	missense	possibly damaging	0.94
R7316:Pcnx	UTSW	12	81995549	missense	probably benign	0.16
R7559:Pcnx	UTSW	12	81993122	missense	unknown
R7635:Pcnx	UTSW	12	81919125	missense
R7669:Pcnx	UTSW	12	81990551	missense	probably damaging	1.00
R8021:Pcnx	UTSW	12	81918819	nonsense	probably null
R8049:Pcnx	UTSW	12	81918819	nonsense	probably null
RF024:Pcnx	UTSW	12	81917727	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918202	missense	probably damaging	0.98
Z1177:Pcnx	UTSW	12	81918677	missense

Predicted Primers

PCR Primer
(F):5'- ATAGTCCAGGCAGCTCCTTC -3'
(R):5'- TAGCGTCCAGTCAAGACTTCTG -3'

Sequencing Primer
(F):5'- CTGCTCTGTCTGTGTTGAAAATAC -3'
(R):5'- GACTTTTGAGATGAAGGATGCTTACC -3'

Posted On

2018-08-01