Incidental Mutation 'R6753:Ccdc73'
ID 530874
Institutional Source Beutler Lab
Gene Symbol Ccdc73
Ensembl Gene ENSMUSG00000045106
Gene Name coiled-coil domain containing 73
Synonyms 2210415I11Rik
MMRRC Submission 044870-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.079) question?
Stock # R6753 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 104716669-104830082 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 104821869 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Stop codon at position 606 (L606*)
Ref Sequence ENSEMBL: ENSMUSP00000106743 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111114] [ENSMUST00000151764]
AlphaFold Q8CDM4
Predicted Effect probably null
Transcript: ENSMUST00000111114
AA Change: L606*
SMART Domains Protein: ENSMUSP00000106743
Gene: ENSMUSG00000045106
AA Change: L606*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
Pfam:CCDC73 27 1061 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151764
SMART Domains Protein: ENSMUSP00000120706
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
coiled coil region 48 134 N/A INTRINSIC
coiled coil region 178 381 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 99% (68/69)
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatk G A 11: 119,900,977 (GRCm39) P1083S probably benign Het
Abcb5 T A 12: 118,908,641 (GRCm39) N101I possibly damaging Het
Adrb2 A G 18: 62,312,624 (GRCm39) V67A possibly damaging Het
Agk T A 6: 40,345,504 (GRCm39) probably null Het
Akap10 A T 11: 61,777,603 (GRCm39) M586K probably damaging Het
Akt3 A T 1: 176,877,756 (GRCm39) Y337* probably null Het
Armc1 A G 3: 19,198,562 (GRCm39) F133L possibly damaging Het
Bank1 T C 3: 135,799,069 (GRCm39) E424G probably damaging Het
Cacna1a A G 8: 85,306,834 (GRCm39) E1363G probably damaging Het
Cacna1d C A 14: 29,764,743 (GRCm39) A2076S probably damaging Het
Ccdc8 C T 7: 16,730,562 (GRCm39) Q684* probably null Het
Ces1b T A 8: 93,793,648 (GRCm39) K314* probably null Het
Ces1e T A 8: 93,941,756 (GRCm39) N238I probably damaging Het
Chd4 A G 6: 125,091,263 (GRCm39) N1238S probably benign Het
Cmtr2 T A 8: 110,949,611 (GRCm39) D640E probably damaging Het
Col7a1 C T 9: 108,787,196 (GRCm39) T559I unknown Het
Comt T C 16: 18,226,771 (GRCm39) K205R probably benign Het
Dbp A T 7: 45,357,828 (GRCm39) E232V probably damaging Het
Dcbld2 A G 16: 58,276,493 (GRCm39) T470A possibly damaging Het
Eml6 T A 11: 29,704,987 (GRCm39) D1519V probably damaging Het
Evpl T A 11: 116,128,732 (GRCm39) H31L possibly damaging Het
Exoc1 T A 5: 76,711,186 (GRCm39) I86N probably damaging Het
Fat3 C T 9: 15,826,357 (GRCm39) E4532K possibly damaging Het
Fgfr3 T C 5: 33,889,503 (GRCm39) S301P probably benign Het
Gas2l1 C T 11: 5,014,254 (GRCm39) V69I probably damaging Het
Gm2042 T A 12: 87,924,854 (GRCm39) I107K probably damaging Het
Gucy1b1 T C 3: 81,947,054 (GRCm39) D385G probably null Het
Ints1 T A 5: 139,750,930 (GRCm39) E824D probably damaging Het
Itfg1 T C 8: 86,561,707 (GRCm39) D142G probably benign Het
Jaml A G 9: 45,018,677 (GRCm39) N359D probably benign Het
Kcnh7 T A 2: 62,680,721 (GRCm39) I289L probably benign Het
Klf12 G A 14: 100,347,212 (GRCm39) Q40* probably null Het
Mcm4 A C 16: 15,447,226 (GRCm39) N579K possibly damaging Het
Mfsd2b A T 12: 4,917,358 (GRCm39) F179I possibly damaging Het
Mmp11 C T 10: 75,764,208 (GRCm39) V86M probably damaging Het
Mogs T C 6: 83,092,863 (GRCm39) V101A probably damaging Het
Narf T A 11: 121,133,452 (GRCm39) H84Q probably benign Het
Or5ak4 C A 2: 85,162,142 (GRCm39) M33I probably benign Het
Otog A C 7: 45,898,495 (GRCm39) E204D probably benign Het
Parp8 G A 13: 117,031,651 (GRCm39) H354Y possibly damaging Het
Pcnx1 C A 12: 82,011,254 (GRCm39) D1238E probably damaging Het
Pi4ka A G 16: 17,194,846 (GRCm39) L184P possibly damaging Het
Pkd1l3 C T 8: 110,351,081 (GRCm39) T642I probably damaging Het
Pkhd1l1 G A 15: 44,453,059 (GRCm39) E3995K probably benign Het
Prdm9 A T 17: 15,765,218 (GRCm39) Y521N probably benign Het
Prex2 A G 1: 11,254,680 (GRCm39) S1105G probably damaging Het
Prss35 T A 9: 86,638,153 (GRCm39) F308I probably damaging Het
Rab22a C T 2: 173,542,848 (GRCm39) A167V probably benign Het
Rims2 A G 15: 39,430,369 (GRCm39) Q871R possibly damaging Het
Rorb A T 19: 18,934,611 (GRCm39) M253K probably benign Het
Ryr3 T C 2: 112,482,955 (GRCm39) D4269G probably damaging Het
Snx11 T C 11: 96,660,732 (GRCm39) probably benign Het
Son A G 16: 91,454,076 (GRCm39) Q941R probably damaging Het
Sptbn2 G T 19: 4,797,813 (GRCm39) R1880L probably benign Het
Sun1 G A 5: 139,201,014 (GRCm39) probably null Het
Tprn A G 2: 25,154,050 (GRCm39) R451G probably benign Het
Trbv30 T A 6: 41,258,311 (GRCm39) M1K probably null Het
Ttn C A 2: 76,568,565 (GRCm39) G25697W probably damaging Het
Ubb T G 11: 62,442,353 (GRCm39) probably null Het
Unc13b C T 4: 43,239,331 (GRCm39) R1038C probably damaging Het
Usp7 T C 16: 8,514,775 (GRCm39) M687V probably benign Het
Zfp160 G A 17: 21,240,996 (GRCm39) M21I probably benign Het
Zfp868 T C 8: 70,064,747 (GRCm39) N196S probably benign Het
Zup1 A T 10: 33,804,025 (GRCm39) I483N probably damaging Het
Other mutations in Ccdc73
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Ccdc73 APN 2 104,824,936 (GRCm39) missense probably damaging 1.00
IGL01313:Ccdc73 APN 2 104,737,972 (GRCm39) missense probably benign 0.00
IGL02016:Ccdc73 APN 2 104,805,961 (GRCm39) missense probably benign 0.05
IGL02179:Ccdc73 APN 2 104,737,913 (GRCm39) missense probably damaging 0.99
FR4304:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
FR4737:Ccdc73 UTSW 2 104,822,185 (GRCm39) unclassified probably benign
IGL03052:Ccdc73 UTSW 2 104,782,281 (GRCm39) missense possibly damaging 0.78
R0010:Ccdc73 UTSW 2 104,811,332 (GRCm39) splice site probably benign
R0040:Ccdc73 UTSW 2 104,822,429 (GRCm39) missense probably damaging 1.00
R0052:Ccdc73 UTSW 2 104,759,915 (GRCm39) splice site probably benign
R0360:Ccdc73 UTSW 2 104,811,352 (GRCm39) missense probably damaging 1.00
R0401:Ccdc73 UTSW 2 104,821,634 (GRCm39) missense probably benign 0.01
R0715:Ccdc73 UTSW 2 104,803,499 (GRCm39) splice site probably benign
R0839:Ccdc73 UTSW 2 104,821,442 (GRCm39) missense probably benign 0.05
R1129:Ccdc73 UTSW 2 104,822,535 (GRCm39) missense possibly damaging 0.51
R1240:Ccdc73 UTSW 2 104,821,906 (GRCm39) missense probably benign 0.05
R1478:Ccdc73 UTSW 2 104,745,012 (GRCm39) missense possibly damaging 0.93
R1478:Ccdc73 UTSW 2 104,737,955 (GRCm39) missense possibly damaging 0.72
R1695:Ccdc73 UTSW 2 104,822,450 (GRCm39) missense probably damaging 1.00
R1924:Ccdc73 UTSW 2 104,822,637 (GRCm39) missense probably damaging 1.00
R1950:Ccdc73 UTSW 2 104,757,280 (GRCm39) missense probably benign 0.01
R1987:Ccdc73 UTSW 2 104,829,504 (GRCm39) missense probably damaging 1.00
R1987:Ccdc73 UTSW 2 104,761,390 (GRCm39) nonsense probably null
R2938:Ccdc73 UTSW 2 104,805,980 (GRCm39) nonsense probably null
R3420:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3420:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3422:Ccdc73 UTSW 2 104,782,293 (GRCm39) splice site probably null
R3422:Ccdc73 UTSW 2 104,782,292 (GRCm39) missense probably null 1.00
R3522:Ccdc73 UTSW 2 104,821,830 (GRCm39) missense probably damaging 1.00
R3886:Ccdc73 UTSW 2 104,821,688 (GRCm39) missense possibly damaging 0.94
R4279:Ccdc73 UTSW 2 104,815,355 (GRCm39) missense possibly damaging 0.87
R4791:Ccdc73 UTSW 2 104,811,450 (GRCm39) splice site probably null
R4793:Ccdc73 UTSW 2 104,848,127 (GRCm39) splice site probably null
R4939:Ccdc73 UTSW 2 104,822,502 (GRCm39) splice site probably null
R4950:Ccdc73 UTSW 2 104,822,711 (GRCm39) missense probably benign
R5093:Ccdc73 UTSW 2 104,848,111 (GRCm39) utr 3 prime probably benign
R5150:Ccdc73 UTSW 2 104,822,384 (GRCm39) missense probably benign 0.00
R5381:Ccdc73 UTSW 2 104,820,270 (GRCm39) missense probably damaging 1.00
R5738:Ccdc73 UTSW 2 104,761,331 (GRCm39) missense possibly damaging 0.78
R6148:Ccdc73 UTSW 2 104,822,482 (GRCm39) missense possibly damaging 0.58
R6269:Ccdc73 UTSW 2 104,737,978 (GRCm39) missense probably damaging 1.00
R6738:Ccdc73 UTSW 2 104,822,433 (GRCm39) missense probably benign 0.00
R7062:Ccdc73 UTSW 2 104,782,223 (GRCm39) missense probably damaging 1.00
R7110:Ccdc73 UTSW 2 104,803,569 (GRCm39) missense probably benign 0.21
R7320:Ccdc73 UTSW 2 104,829,521 (GRCm39) missense possibly damaging 0.47
R7436:Ccdc73 UTSW 2 104,782,214 (GRCm39) missense probably damaging 1.00
R7530:Ccdc73 UTSW 2 104,824,915 (GRCm39) missense
R7747:Ccdc73 UTSW 2 104,759,901 (GRCm39) missense probably damaging 1.00
R7952:Ccdc73 UTSW 2 104,775,801 (GRCm39) critical splice donor site probably null
R8178:Ccdc73 UTSW 2 104,821,557 (GRCm39) missense probably benign 0.00
R8824:Ccdc73 UTSW 2 104,822,222 (GRCm39) missense possibly damaging 0.74
R8927:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8928:Ccdc73 UTSW 2 104,822,542 (GRCm39) missense
R8945:Ccdc73 UTSW 2 104,821,712 (GRCm39) missense probably benign 0.03
R9365:Ccdc73 UTSW 2 104,738,011 (GRCm39) missense probably damaging 1.00
Z1177:Ccdc73 UTSW 2 104,822,584 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGACAGTAGAAAATCAGTCACTG -3'
(R):5'- ATAGCAAGAACGGGGCTCTG -3'

Sequencing Primer
(F):5'- CTTGGAAAAAGCCAGTGGATGTTC -3'
(R):5'- AAGAACGGGGCTCTGTGCTG -3'
Posted On 2018-08-01