Incidental Mutation 'R6805:Hpse2'
ID 533566
Institutional Source Beutler Lab
Gene Symbol Hpse2
Ensembl Gene ENSMUSG00000074852
Gene Name heparanase 2
Synonyms LOC381226
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.284) question?
Stock # R6805 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 42788947-43388311 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) A to T at 43294321 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 164 (C164*)
Ref Sequence ENSEMBL: ENSMUSP00000097026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099428]
AlphaFold B2RY83
Predicted Effect probably null
Transcript: ENSMUST00000099428
AA Change: C164*
SMART Domains Protein: ENSMUSP00000097026
Gene: ENSMUSG00000074852
AA Change: C164*

DomainStartEndE-ValueType
signal peptide 1 38 N/A INTRINSIC
Pfam:Glyco_hydro_79n 168 408 6.6e-22 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a heparanase enzyme. The encoded protein is a endoglycosidase that degrades heparin sulfate proteoglycans located on the extracellular matrix and cell surface. This protein may be involved in biological processes involving remodeling of the extracellular matrix including angiogenesis and tumor progression. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2009]
PHENOTYPE: Mice homozygous for a gene-trapped allele exhibit growth retardation, a distended urinary bladder, abnormal voiding behavior, proteinuria, renal dysfunction and malnutrition, reduced cell proliferation, urinary bladder fibrosis, and lethality within one month of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
Srcin1 T A 11: 97,551,980 probably null Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Hpse2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01610:Hpse2 APN 19 43384789 missense probably benign
IGL02315:Hpse2 APN 19 42966947 splice site probably benign
IGL02324:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02328:Hpse2 APN 19 42931599 missense probably damaging 1.00
IGL02388:Hpse2 APN 19 43294253 missense probably damaging 1.00
IGL02977:Hpse2 APN 19 42789122 splice site probably benign
nobility UTSW 19 43388070 missense probably damaging 1.00
R0147:Hpse2 UTSW 19 42931660 splice site probably null
R0148:Hpse2 UTSW 19 42931660 splice site probably null
R0472:Hpse2 UTSW 19 43013163 missense probably damaging 0.99
R0892:Hpse2 UTSW 19 43388146 missense probably benign 0.31
R1033:Hpse2 UTSW 19 42913199 missense probably benign 0.41
R1242:Hpse2 UTSW 19 42966977 missense probably benign 0.00
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1470:Hpse2 UTSW 19 43388253 missense probably benign 0.03
R1611:Hpse2 UTSW 19 42789065 missense probably damaging 1.00
R2382:Hpse2 UTSW 19 42931622 missense probably benign 0.04
R2496:Hpse2 UTSW 19 43013043 critical splice donor site probably null
R2982:Hpse2 UTSW 19 43384743 missense probably null 0.99
R4056:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4057:Hpse2 UTSW 19 43294275 missense probably damaging 1.00
R4434:Hpse2 UTSW 19 43294269 missense probably benign 0.00
R4762:Hpse2 UTSW 19 42789071 missense possibly damaging 0.52
R4856:Hpse2 UTSW 19 42788957 missense probably damaging 1.00
R4886:Hpse2 UTSW 19 43384764 missense probably damaging 1.00
R5018:Hpse2 UTSW 19 43384824 missense possibly damaging 0.57
R6289:Hpse2 UTSW 19 42788979 missense probably null 1.00
R6382:Hpse2 UTSW 19 43388202 missense possibly damaging 0.93
R7528:Hpse2 UTSW 19 42813024 missense probably damaging 1.00
R7793:Hpse2 UTSW 19 43388070 missense probably damaging 1.00
R7944:Hpse2 UTSW 19 43384809 missense probably benign 0.05
R7945:Hpse2 UTSW 19 43384809 missense probably benign 0.05
R9731:Hpse2 UTSW 19 42806387 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGGATGCCACACTAGCAG -3'
(R):5'- TGGAACTAAAGGACCTTCAGGG -3'

Sequencing Primer
(F):5'- TAGCAGGTCCCAAGCACTCG -3'
(R):5'- CTGTCATGCTGGATAAAACAA -3'
Posted On 2018-09-12