Incidental Mutation 'R6805:Srcin1'
ID 533547
Institutional Source Beutler Lab
Gene Symbol Srcin1
Ensembl Gene ENSMUSG00000038453
Gene Name SRC kinase signaling inhibitor 1
Synonyms p140Cap, P140
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R6805 (G1)
Quality Score 115.008
Status Validated
Chromosome 11
Chromosomal Location 97509340-97576186 bp(-) (GRCm38)
Type of Mutation critical splice acceptor site
DNA Base Change (assembly) T to A at 97551980 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000146591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107590] [ENSMUST00000107590] [ENSMUST00000107590] [ENSMUST00000107593] [ENSMUST00000107593] [ENSMUST00000107593] [ENSMUST00000107596] [ENSMUST00000107596] [ENSMUST00000107596] [ENSMUST00000126287] [ENSMUST00000126287] [ENSMUST00000126287] [ENSMUST00000207653] [ENSMUST00000207653] [ENSMUST00000207653]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000107590
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107590
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107590
SMART Domains Protein: ENSMUSP00000103216
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107593
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107593
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107593
SMART Domains Protein: ENSMUSP00000103219
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 1e-9 BLAST
low complexity region 332 366 N/A INTRINSIC
low complexity region 489 501 N/A INTRINSIC
low complexity region 516 538 N/A INTRINSIC
low complexity region 558 575 N/A INTRINSIC
low complexity region 655 679 N/A INTRINSIC
low complexity region 699 712 N/A INTRINSIC
coiled coil region 751 784 N/A INTRINSIC
low complexity region 1034 1051 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107596
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107596
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000107596
SMART Domains Protein: ENSMUSP00000103222
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 32 41 N/A INTRINSIC
Blast:THAP 79 108 8e-10 BLAST
low complexity region 118 128 N/A INTRINSIC
Pfam:AIP3 218 330 2e-11 PFAM
low complexity region 331 365 N/A INTRINSIC
low complexity region 488 500 N/A INTRINSIC
low complexity region 515 537 N/A INTRINSIC
low complexity region 557 574 N/A INTRINSIC
low complexity region 654 678 N/A INTRINSIC
low complexity region 698 711 N/A INTRINSIC
coiled coil region 750 783 N/A INTRINSIC
low complexity region 1033 1050 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126287
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126287
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000126287
SMART Domains Protein: ENSMUSP00000116444
Gene: ENSMUSG00000038453

DomainStartEndE-ValueType
low complexity region 26 45 N/A INTRINSIC
low complexity region 66 75 N/A INTRINSIC
Blast:THAP 113 142 7e-10 BLAST
low complexity region 152 162 N/A INTRINSIC
Pfam:AIP3 244 339 9.7e-10 PFAM
low complexity region 357 391 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000207653
Predicted Effect probably null
Transcript: ENSMUST00000207653
Predicted Effect probably null
Transcript: ENSMUST00000207653
Meta Mutation Damage Score 0.9503 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.8%
  • 20x: 97.1%
Validation Efficiency 98% (62/63)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele display abnormalities in object recognition memory and motor learning, dendritic spine disorganization, impaired synaptic plasticity, and reduced long term potentiation and long term depression. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,244,306 V2591A probably benign Het
4930407I10Rik A G 15: 82,062,543 T214A possibly damaging Het
A930009A15Rik G T 10: 115,579,905 probably benign Het
Aadac A C 3: 60,037,336 D143A probably benign Het
Acot10 T G 15: 20,665,366 T430P probably benign Het
Adgrb3 T C 1: 25,826,172 T197A possibly damaging Het
B230118H07Rik T C 2: 101,566,459 K192E probably benign Het
Bbs1 A G 19: 4,900,615 I200T probably damaging Het
C1ra G A 6: 124,517,725 E316K probably benign Het
Cadps G A 14: 12,467,103 A943V probably damaging Het
Cc2d2a A G 5: 43,681,331 E48G probably damaging Het
Clca1 A T 3: 145,018,667 C211S probably damaging Het
Col18a1 A G 10: 77,054,239 L1429P probably damaging Het
Cul2 T G 18: 3,421,263 Y196D probably damaging Het
D630023F18Rik T C 1: 65,117,206 S43G probably benign Het
Ddx39 G A 8: 83,723,137 R427Q probably damaging Het
Def6 A G 17: 28,223,717 T285A probably damaging Het
Defb21 T A 2: 152,574,869 D88E probably benign Het
Defb6 A G 8: 19,228,101 K63R probably benign Het
Dnph1 T C 17: 46,498,744 S112P probably damaging Het
Dock10 T A 1: 80,586,690 I467L probably benign Het
Dspp C A 5: 104,175,850 H286Q probably benign Het
Eya1 T A 1: 14,183,277 T459S probably benign Het
Faf1 T C 4: 109,861,852 L385P probably damaging Het
Fbxw21 C A 9: 109,157,565 R82L probably damaging Het
Fryl A G 5: 73,065,094 V2048A probably benign Het
Galnt5 A T 2: 58,035,299 D864V possibly damaging Het
Gata6 T G 18: 11,054,460 S130A possibly damaging Het
Gbf1 G T 19: 46,262,507 R434L probably damaging Het
Gga3 A G 11: 115,585,762 F709L probably damaging Het
Hcar1 A G 5: 123,879,130 V166A probably benign Het
Hexa T A 9: 59,563,937 N491K possibly damaging Het
Hpse2 A T 19: 43,294,321 C164* probably null Het
Ifi202b T C 1: 173,974,989 Y93C probably damaging Het
Iscu T A 5: 113,775,243 I79N probably damaging Het
Jmjd7 T A 2: 120,031,323 Y182* probably null Het
Jup A T 11: 100,383,458 D135E probably benign Het
Kit T A 5: 75,652,808 I881N probably damaging Het
Llgl1 T A 11: 60,702,865 S55T probably benign Het
Lonp2 G A 8: 86,709,096 M653I probably benign Het
Lrp8 T C 4: 107,854,320 Y307H probably damaging Het
Med13 A T 11: 86,278,796 M1914K possibly damaging Het
Ms4a1 A G 19: 11,253,173 probably null Het
Naip1 A G 13: 100,427,341 S439P probably benign Het
Nrg1 T C 8: 31,821,264 R476G probably damaging Het
Olfr1129 T A 2: 87,574,918 probably null Het
Olfr835 G T 9: 19,035,301 M59I probably damaging Het
Pds5b T A 5: 150,805,561 probably null Het
Phf12 G A 11: 78,027,373 G804R probably damaging Het
Pou6f2 T C 13: 18,239,489 T234A Het
Prune2 A T 19: 17,120,590 I1153L probably benign Het
Ptprc C T 1: 138,067,885 probably null Het
Qpctl T C 7: 19,149,154 Q11R probably benign Het
Rfx4 A G 10: 84,840,228 K103E possibly damaging Het
St6galnac1 G T 11: 116,768,944 A181D probably damaging Het
Stk36 T C 1: 74,622,239 V475A probably benign Het
Tbc1d21 T C 9: 58,361,288 T263A possibly damaging Het
Tex24 A T 8: 27,345,000 K185N probably damaging Het
Tnxb T A 17: 34,698,153 V2174E possibly damaging Het
Tollip A G 7: 141,890,845 S57P probably benign Het
Zbtb49 A G 5: 38,213,241 probably benign Het
Zfp758 A G 17: 22,361,669 T30A probably benign Het
Other mutations in Srcin1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Srcin1 APN 11 97533098 missense possibly damaging 0.81
IGL03347:Srcin1 APN 11 97525344 missense probably damaging 1.00
R1619:Srcin1 UTSW 11 97525481 missense probably damaging 1.00
R1678:Srcin1 UTSW 11 97518644 missense probably damaging 0.99
R1733:Srcin1 UTSW 11 97533501 missense probably benign
R2023:Srcin1 UTSW 11 97526046 missense probably benign
R2238:Srcin1 UTSW 11 97534819 missense probably benign 0.00
R3983:Srcin1 UTSW 11 97525553 missense probably damaging 1.00
R4572:Srcin1 UTSW 11 97534934 missense probably damaging 1.00
R4628:Srcin1 UTSW 11 97548926 missense probably benign 0.12
R4946:Srcin1 UTSW 11 97551942 missense probably damaging 1.00
R5175:Srcin1 UTSW 11 97573877 missense probably damaging 0.99
R5424:Srcin1 UTSW 11 97537059 nonsense probably null
R5705:Srcin1 UTSW 11 97548951 missense probably benign 0.42
R5918:Srcin1 UTSW 11 97533497 splice site probably null
R6563:Srcin1 UTSW 11 97534774 missense possibly damaging 0.74
R6613:Srcin1 UTSW 11 97533827 missense possibly damaging 0.94
R6756:Srcin1 UTSW 11 97535010 missense probably damaging 1.00
R7060:Srcin1 UTSW 11 97573885 missense probably damaging 0.99
R7271:Srcin1 UTSW 11 97551889 missense probably damaging 0.99
R7304:Srcin1 UTSW 11 97551693 missense probably benign 0.01
R7469:Srcin1 UTSW 11 97534609 missense probably damaging 0.98
R7567:Srcin1 UTSW 11 97534725 missense probably damaging 1.00
R7846:Srcin1 UTSW 11 97526100 nonsense probably null
R7994:Srcin1 UTSW 11 97531916 missense probably damaging 1.00
R8203:Srcin1 UTSW 11 97566713 missense probably damaging 1.00
R8377:Srcin1 UTSW 11 97551978 missense probably damaging 0.99
R8488:Srcin1 UTSW 11 97525860 splice site probably null
R8559:Srcin1 UTSW 11 97537149 missense probably damaging 1.00
R8690:Srcin1 UTSW 11 97523542 missense probably damaging 1.00
R8794:Srcin1 UTSW 11 97548977 missense probably benign 0.00
R8982:Srcin1 UTSW 11 97535798 missense probably damaging 1.00
R9061:Srcin1 UTSW 11 97536380 missense probably damaging 1.00
R9253:Srcin1 UTSW 11 97525551 missense probably damaging 1.00
R9632:Srcin1 UTSW 11 97551822 missense probably benign 0.11
X0024:Srcin1 UTSW 11 97536468 missense probably damaging 1.00
Z1176:Srcin1 UTSW 11 97518727 missense possibly damaging 0.88
Z1177:Srcin1 UTSW 11 97526861 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CATGAACGCATCTCGCTTGC -3'
(R):5'- CCCCAACTTGCAATTCTAAGTTCAC -3'

Sequencing Primer
(F):5'- TTTCTGGAGCCCGCTGAG -3'
(R):5'- GCAATTCTAAGTTCACCTCATATACC -3'
Posted On 2018-09-12