Mutagenetix > Incidental Mutation

Incidental Mutation 'R6805:Galnt5'

533514

Institutional Source

Beutler Lab

Gene Symbol

Galnt5

Ensembl Gene

ENSMUSG00000026828

Gene Name

polypeptide N-acetylgalactosaminyltransferase 5

Synonyms

ppGaNTase-T5

MMRRC Submission

044918-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6805 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

57997884-58045860 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 58035299 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 864 (D864V)

Ref Sequence

ENSEMBL: ENSMUSP00000131362 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000112616] [ENSMUST00000166729]

AlphaFold

Q8C102

Predicted Effect

possibly damaging
Transcript: ENSMUST00000112616
AA Change: D864V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000108235
Gene: ENSMUSG00000026828
AA Change: D864V

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	1.3e-33	PFAM
Pfam:Glyco_transf_7C	653	718	1.9e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000166729
AA Change: D864V

PolyPhen 2 Score 0.819 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000131362
Gene: ENSMUSG00000026828
AA Change: D864V

Domain	Start	End	E-Value	Type
transmembrane domain	13	35	N/A	INTRINSIC
low complexity region	319	330	N/A	INTRINSIC
Pfam:Glycos_transf_2	489	672	2.1e-30	PFAM
Pfam:Glyco_transf_7C	652	718	7e-8	PFAM
RICIN	801	925	1.36e-19	SMART

Meta Mutation Damage Score

0.3990

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.8%
20x: 97.1%

Validation Efficiency

98% (62/63)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane-bound polypeptide N-acetylgalactosaminyltransferase that is found in the Golgi. The encoded protein catalyzes the first step in the mucin-type O-glycosylation of Golgi proteins, transfering an N-acetyl-D-galactosamine residue to a serine or threonine residue on the protein receptor. [provided by RefSeq, Aug 2016]
PHENOTYPE: An unpublished knockout mutation is reported to have no overt phenotypic consequences. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	T	C	15: 8,244,306	V2591A	probably benign	Het
4930407I10Rik	A	G	15: 82,062,543	T214A	possibly damaging	Het
A930009A15Rik	G	T	10: 115,579,905		probably benign	Het
Aadac	A	C	3: 60,037,336	D143A	probably benign	Het
Acot10	T	G	15: 20,665,366	T430P	probably benign	Het
Adgrb3	T	C	1: 25,826,172	T197A	possibly damaging	Het
B230118H07Rik	T	C	2: 101,566,459	K192E	probably benign	Het
Bbs1	A	G	19: 4,900,615	I200T	probably damaging	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
Cadps	G	A	14: 12,467,103	A943V	probably damaging	Het
Cc2d2a	A	G	5: 43,681,331	E48G	probably damaging	Het
Clca1	A	T	3: 145,018,667	C211S	probably damaging	Het
Col18a1	A	G	10: 77,054,239	L1429P	probably damaging	Het
Cul2	T	G	18: 3,421,263	Y196D	probably damaging	Het
D630023F18Rik	T	C	1: 65,117,206	S43G	probably benign	Het
Ddx39	G	A	8: 83,723,137	R427Q	probably damaging	Het
Def6	A	G	17: 28,223,717	T285A	probably damaging	Het
Defb21	T	A	2: 152,574,869	D88E	probably benign	Het
Defb6	A	G	8: 19,228,101	K63R	probably benign	Het
Dnph1	T	C	17: 46,498,744	S112P	probably damaging	Het
Dock10	T	A	1: 80,586,690	I467L	probably benign	Het
Dspp	C	A	5: 104,175,850	H286Q	probably benign	Het
Eya1	T	A	1: 14,183,277	T459S	probably benign	Het
Faf1	T	C	4: 109,861,852	L385P	probably damaging	Het
Fbxw21	C	A	9: 109,157,565	R82L	probably damaging	Het
Fryl	A	G	5: 73,065,094	V2048A	probably benign	Het
Gata6	T	G	18: 11,054,460	S130A	possibly damaging	Het
Gbf1	G	T	19: 46,262,507	R434L	probably damaging	Het
Gga3	A	G	11: 115,585,762	F709L	probably damaging	Het
Hcar1	A	G	5: 123,879,130	V166A	probably benign	Het
Hexa	T	A	9: 59,563,937	N491K	possibly damaging	Het
Hpse2	A	T	19: 43,294,321	C164*	probably null	Het
Ifi202b	T	C	1: 173,974,989	Y93C	probably damaging	Het
Iscu	T	A	5: 113,775,243	I79N	probably damaging	Het
Jmjd7	T	A	2: 120,031,323	Y182*	probably null	Het
Jup	A	T	11: 100,383,458	D135E	probably benign	Het
Kit	T	A	5: 75,652,808	I881N	probably damaging	Het
Llgl1	T	A	11: 60,702,865	S55T	probably benign	Het
Lonp2	G	A	8: 86,709,096	M653I	probably benign	Het
Lrp8	T	C	4: 107,854,320	Y307H	probably damaging	Het
Med13	A	T	11: 86,278,796	M1914K	possibly damaging	Het
Ms4a1	A	G	19: 11,253,173		probably null	Het
Naip1	A	G	13: 100,427,341	S439P	probably benign	Het
Nrg1	T	C	8: 31,821,264	R476G	probably damaging	Het
Olfr1129	T	A	2: 87,574,918		probably null	Het
Olfr835	G	T	9: 19,035,301	M59I	probably damaging	Het
Pds5b	T	A	5: 150,805,561		probably null	Het
Phf12	G	A	11: 78,027,373	G804R	probably damaging	Het
Pou6f2	T	C	13: 18,239,489	T234A		Het
Prune2	A	T	19: 17,120,590	I1153L	probably benign	Het
Ptprc	C	T	1: 138,067,885		probably null	Het
Qpctl	T	C	7: 19,149,154	Q11R	probably benign	Het
Rfx4	A	G	10: 84,840,228	K103E	possibly damaging	Het
Srcin1	T	A	11: 97,551,980		probably null	Het
St6galnac1	G	T	11: 116,768,944	A181D	probably damaging	Het
Stk36	T	C	1: 74,622,239	V475A	probably benign	Het
Tbc1d21	T	C	9: 58,361,288	T263A	possibly damaging	Het
Tex24	A	T	8: 27,345,000	K185N	probably damaging	Het
Tnxb	T	A	17: 34,698,153	V2174E	possibly damaging	Het
Tollip	A	G	7: 141,890,845	S57P	probably benign	Het
Zbtb49	A	G	5: 38,213,241		probably benign	Het
Zfp758	A	G	17: 22,361,669	T30A	probably benign	Het

Other mutations in Galnt5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00230:Galnt5	APN	2	57998973	missense	probably benign
IGL00515:Galnt5	APN	2	57999068	missense	probably benign	0.02
IGL00950:Galnt5	APN	2	57999132	missense	probably benign	0.00
IGL00973:Galnt5	APN	2	57998939	missense	probably benign	0.02
IGL01152:Galnt5	APN	2	58025393	missense	probably benign	0.17
IGL01305:Galnt5	APN	2	58025342	nonsense	probably null
IGL01661:Galnt5	APN	2	57999482	missense	probably benign	0.03
IGL01719:Galnt5	APN	2	57998543	missense	probably damaging	1.00
IGL02165:Galnt5	APN	2	57998865	missense	probably benign
IGL02795:Galnt5	APN	2	58027871	missense	probably damaging	1.00
IGL02943:Galnt5	APN	2	57999768	missense	probably damaging	1.00
IGL03218:Galnt5	APN	2	57999389	missense	possibly damaging	0.59
ANU22:Galnt5	UTSW	2	58025342	nonsense	probably null
R0082:Galnt5	UTSW	2	57999035	missense	possibly damaging	0.92
R0113:Galnt5	UTSW	2	57998877	missense	probably benign
R0445:Galnt5	UTSW	2	57998950	missense	probably benign
R0517:Galnt5	UTSW	2	58035373	splice site	probably benign
R0609:Galnt5	UTSW	2	58024625	missense	possibly damaging	0.90
R0639:Galnt5	UTSW	2	57999395	missense	probably benign	0.07
R0646:Galnt5	UTSW	2	57999085	missense	probably benign	0.00
R0677:Galnt5	UTSW	2	57998980	nonsense	probably null
R1808:Galnt5	UTSW	2	58026125	missense	probably benign	0.24
R1927:Galnt5	UTSW	2	57998603	missense	probably benign	0.00
R1980:Galnt5	UTSW	2	58024723	critical splice donor site	probably null
R2517:Galnt5	UTSW	2	57999413	missense	probably benign	0.00
R4044:Galnt5	UTSW	2	57998460	missense	probably damaging	1.00
R4154:Galnt5	UTSW	2	57998493	missense	probably damaging	1.00
R4411:Galnt5	UTSW	2	57999195	missense	probably benign	0.01
R4703:Galnt5	UTSW	2	57998907	missense	possibly damaging	0.96
R4767:Galnt5	UTSW	2	58028144	missense	possibly damaging	0.91
R5118:Galnt5	UTSW	2	58015003	missense	probably damaging	1.00
R5497:Galnt5	UTSW	2	58025328	missense	probably damaging	0.99
R5506:Galnt5	UTSW	2	57999625	missense	probably benign
R5548:Galnt5	UTSW	2	58014910	missense	probably damaging	0.99
R5758:Galnt5	UTSW	2	57998430	missense	probably benign	0.19
R5937:Galnt5	UTSW	2	58038937	missense	probably benign	0.00
R6237:Galnt5	UTSW	2	58035249	missense	probably damaging	0.96
R6959:Galnt5	UTSW	2	57999219	missense	probably benign	0.39
R7070:Galnt5	UTSW	2	57998609	missense	probably benign	0.00
R7179:Galnt5	UTSW	2	57998609	missense	probably benign	0.06
R7347:Galnt5	UTSW	2	58017193	missense	probably benign	0.33
R7419:Galnt5	UTSW	2	58014925	missense	probably damaging	1.00
R7426:Galnt5	UTSW	2	58017139	missense	probably damaging	0.99
R7492:Galnt5	UTSW	2	58026036	splice site	probably null
R7539:Galnt5	UTSW	2	58035230	missense	probably damaging	0.99
R7623:Galnt5	UTSW	2	58017210	missense	probably damaging	0.99
R8135:Galnt5	UTSW	2	58014868	missense	probably damaging	1.00
R8155:Galnt5	UTSW	2	57999415	missense	probably benign	0.01
R8544:Galnt5	UTSW	2	58017148	missense	probably damaging	1.00
R9267:Galnt5	UTSW	2	58035208	missense	possibly damaging	0.58
R9747:Galnt5	UTSW	2	57999465	missense	probably benign	0.11

Predicted Primers

PCR Primer
(F):5'- CAGAGTTCGCATGGTCTCAC -3'
(R):5'- TGGTCTTTATACCCTTGAGTGAAAC -3'

Sequencing Primer
(F):5'- GGTCTCACCTATTGCTGATAAAAGG -3'
(R):5'- AAACTTCACACTATCTCTGTTGTTAC -3'

Posted On

2018-09-12