Incidental Mutation 'R6990:Ppp2cb'
ID543201
Institutional Source Beutler Lab
Gene Symbol Ppp2cb
Ensembl Gene ENSMUSG00000009630
Gene Nameprotein phosphatase 2 (formerly 2A), catalytic subunit, beta isoform
SynonymsPP2Ac, D8Ertd766e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6990 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location33599625-33619441 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 33619133 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 290 (D290G)
Ref Sequence ENSEMBL: ENSMUSP00000009774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000009774] [ENSMUST00000095349]
Predicted Effect probably benign
Transcript: ENSMUST00000009774
AA Change: D290G

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000009774
Gene: ENSMUSG00000009630
AA Change: D290G

DomainStartEndE-ValueType
PP2Ac 23 293 2.48e-156 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000095349
SMART Domains Protein: ENSMUSP00000092992
Gene: ENSMUSG00000052906

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
low complexity region 70 81 N/A INTRINSIC
Pfam:UBX 192 271 3.8e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the phosphatase 2A catalytic subunit. Protein phosphatase 2A is one of the four major Ser/Thr phosphatases, and it is implicated in the negative control of cell growth and division. It consists of a common heteromeric core enzyme, which is composed of a catalytic subunit and a constant regulatory subunit, that associates with a variety of regulatory subunits. This gene encodes a beta isoform of the catalytic subunit. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610008E11Rik T G 10: 79,067,091 T464P probably damaging Het
Abca16 A G 7: 120,527,727 I1214V probably benign Het
Arap2 A G 5: 62,676,517 F869S probably damaging Het
Astn2 G T 4: 65,992,303 H431N possibly damaging Het
Bap1 A G 14: 31,255,651 T308A probably benign Het
Bcr G A 10: 75,131,036 E492K possibly damaging Het
Camta1 A G 4: 151,145,044 F444L probably damaging Het
Chd7 A T 4: 8,844,525 T1545S probably benign Het
Dnmt1 A T 9: 20,915,814 Y877* probably null Het
Fam13b A G 18: 34,497,447 V86A possibly damaging Het
Gm11562 T A 11: 99,619,991 R128W unknown Het
Krt86 A G 15: 101,473,833 I95V probably benign Het
Mgea5 G A 19: 45,767,476 A576V probably benign Het
Mroh2b A G 15: 4,912,802 T349A possibly damaging Het
Ms4a7 A T 19: 11,333,241 L38Q probably damaging Het
Myo1h T C 5: 114,330,160 S339P probably damaging Het
Nf2 T C 11: 4,799,944 I46V probably benign Het
Nr1h4 T C 10: 89,454,930 D416G probably benign Het
Olfr1179 A G 2: 88,402,295 M213T probably benign Het
Olfr323 T C 11: 58,625,458 E196G probably damaging Het
Pde1c C G 6: 56,442,035 E87Q possibly damaging Het
Peg10 T TCCA 6: 4,756,451 probably benign Het
Pga5 A T 19: 10,669,415 D317E probably benign Het
Pira2 T A 7: 3,841,068 K568N probably damaging Het
Sall4 T C 2: 168,755,070 K617E probably damaging Het
Slc7a14 G A 3: 31,223,579 P626S possibly damaging Het
Speer4b A T 5: 27,497,078 L228* probably null Het
Spns2 T C 11: 72,489,621 T59A probably benign Het
Tbc1d5 A T 17: 50,968,232 N78K probably benign Het
Tmem63a T C 1: 180,961,121 V341A probably benign Het
Trpt1 A G 19: 6,998,315 T146A probably benign Het
Tyrp1 T C 4: 80,835,437 C122R probably damaging Het
Uchl1 A G 5: 66,682,475 E120G possibly damaging Het
Ucn3 C T 13: 3,941,295 R119Q possibly damaging Het
Uhrf1bp1l A G 10: 89,806,117 D1050G probably benign Het
Vmn2r2 T G 3: 64,117,187 I658L probably benign Het
Vmn2r96 T A 17: 18,583,820 V444E probably benign Het
Wdr54 A C 6: 83,155,647 probably null Het
Xcr1 A G 9: 123,856,235 L154P probably benign Het
Zbtb26 T C 2: 37,436,545 K160E probably benign Het
Zfp157 T G 5: 138,456,510 Y323* probably null Het
Zfp850 A T 7: 27,990,376 F136I probably benign Het
Other mutations in Ppp2cb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01566:Ppp2cb APN 8 33611763 missense probably benign 0.38
IGL02985:Ppp2cb APN 8 33615446 unclassified probably benign
IGL03251:Ppp2cb APN 8 33610651 splice site probably benign
Breakthrough UTSW 8 33615474 missense probably damaging 1.00
R0940:Ppp2cb UTSW 8 33615661 splice site probably null
R1688:Ppp2cb UTSW 8 33615452 missense probably benign 0.02
R2187:Ppp2cb UTSW 8 33610677 missense possibly damaging 0.95
R2350:Ppp2cb UTSW 8 33611827 missense probably null 1.00
R4418:Ppp2cb UTSW 8 33617049 missense probably benign
R4566:Ppp2cb UTSW 8 33610695 missense possibly damaging 0.67
R6187:Ppp2cb UTSW 8 33615474 missense probably damaging 1.00
R7477:Ppp2cb UTSW 8 33615474 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TTTCACCATAGCTGTGAAGTGC -3'
(R):5'- ATGGCACGTTTTGGTCCATG -3'

Sequencing Primer
(F):5'- CACCATAGCTGTGAAGTGCTAACTG -3'
(R):5'- GTCCATGATGTGTTTTAATGTCAAG -3'
Posted On2018-11-28