Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Tnfrsf1a'

545447

Institutional Source

Beutler Lab

Gene Symbol

Tnfrsf1a

Ensembl Gene

ENSMUSG00000030341

Gene Name

tumor necrosis factor receptor superfamily, member 1a

Synonyms

CD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125349362-125362484 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 125356951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 56 (S56P)

Ref Sequence

ENSEMBL: ENSMUSP00000115991 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000130257] [ENSMUST00000144524]

AlphaFold

P25118

Predicted Effect

probably damaging
Transcript: ENSMUST00000032491
AA Change: S56P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: S56P

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
TNFR	44	81	2.4e-7	SMART
TNFR	84	125	2.19e-10	SMART
TNFR	127	166	5.43e-6	SMART
TNFR	168	195	3.41e1	SMART
transmembrane domain	212	234	N/A	INTRINSIC
low complexity region	263	276	N/A	INTRINSIC
low complexity region	290	301	N/A	INTRINSIC
DEATH	345	441	8.04e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125880

SMART Domains

Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341

Domain	Start	End	E-Value	Type
TNFR	2	42	2.09e-7	SMART
TNFR	44	83	5.43e-6	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000130257
AA Change: S56P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341
AA Change: S56P

Domain	Start	End	E-Value	Type
signal peptide	1	29	N/A	INTRINSIC
Pfam:TNFR_c6	44	66	1.1e-7	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000144524

SMART Domains

Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341

Domain	Start	End	E-Value	Type
TNFR	5	44	5.43e-6	SMART
TNFR	46	73	3.41e1	SMART
transmembrane domain	90	112	N/A	INTRINSIC
low complexity region	141	154	N/A	INTRINSIC
low complexity region	168	179	N/A	INTRINSIC
Blast:DEATH	223	295	1e-13	BLAST
SCOP:d1icha_	269	295	3e-8	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dip2c	T	A	13: 9,659,278	Y1385N	probably damaging	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Dsg1a	T	C	18: 20,328,738	F299L	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lamc2	T	A	1: 153,136,742	M729L	probably benign	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Rptn	T	C	3: 93,397,900	C847R	possibly damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Strc	A	T	2: 121,369,058	I1300N	probably damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Tnfrsf1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01987:Tnfrsf1a	APN	6	125356864	missense	probably damaging	1.00
IGL02468:Tnfrsf1a	APN	6	125357861	missense	probably benign	0.06
IGL02588:Tnfrsf1a	APN	6	125360766	missense	probably benign	0.44
R1302:Tnfrsf1a	UTSW	6	125356916	missense	probably damaging	1.00
R2189:Tnfrsf1a	UTSW	6	125357805	missense	probably benign	0.42
R4559:Tnfrsf1a	UTSW	6	125360766	missense	probably benign	0.44
R4794:Tnfrsf1a	UTSW	6	125358084	missense	probably damaging	1.00
R5039:Tnfrsf1a	UTSW	6	125360712	missense	possibly damaging	0.67
R5364:Tnfrsf1a	UTSW	6	125357393	missense	possibly damaging	0.87
R5792:Tnfrsf1a	UTSW	6	125358077	missense	probably damaging	1.00
R6742:Tnfrsf1a	UTSW	6	125356948	missense	probably damaging	0.99
R7128:Tnfrsf1a	UTSW	6	125361536	missense	probably benign	0.11
R7192:Tnfrsf1a	UTSW	6	125361596	missense	unknown
R7715:Tnfrsf1a	UTSW	6	125361414	missense	possibly damaging	0.65
R8745:Tnfrsf1a	UTSW	6	125361782	missense	probably damaging	0.99
R8755:Tnfrsf1a	UTSW	6	125357805	missense	probably benign	0.42
R8856:Tnfrsf1a	UTSW	6	125357725	missense	possibly damaging	0.85
R9005:Tnfrsf1a	UTSW	6	125356915	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGTTGCTACCTCTAAGGCCC -3'
(R):5'- CCAAGTAGGTTCCTGTAGATAGGG -3'

Sequencing Primer
(F):5'- TCTAAGGCCCCACCCCTG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'

Posted On

2019-05-13