Incidental Mutation 'R7018:Tnfrsf1a'
ID 545447
Institutional Source Beutler Lab
Gene Symbol Tnfrsf1a
Ensembl Gene ENSMUSG00000030341
Gene Name tumor necrosis factor receptor superfamily, member 1a
Synonyms CD120a, TNFalpha-R1, TNF-R1, p55-R, TNF receptor alpha chain, TNF-R55, TNFRI, TNFRp55, TNFAR, TNFR60, TNF-R-I, Tnfr1, p55, TNF-alpha-R1, TNF-alphaR1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7018 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 125349362-125362484 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 125356951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 56 (S56P)
Ref Sequence ENSEMBL: ENSMUSP00000115991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032491] [ENSMUST00000130257] [ENSMUST00000144524]
AlphaFold P25118
Predicted Effect probably damaging
Transcript: ENSMUST00000032491
AA Change: S56P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000032491
Gene: ENSMUSG00000030341
AA Change: S56P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
TNFR 44 81 2.4e-7 SMART
TNFR 84 125 2.19e-10 SMART
TNFR 127 166 5.43e-6 SMART
TNFR 168 195 3.41e1 SMART
transmembrane domain 212 234 N/A INTRINSIC
low complexity region 263 276 N/A INTRINSIC
low complexity region 290 301 N/A INTRINSIC
DEATH 345 441 8.04e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000125880
SMART Domains Protein: ENSMUSP00000121968
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 2 42 2.09e-7 SMART
TNFR 44 83 5.43e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000130257
AA Change: S56P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115991
Gene: ENSMUSG00000030341
AA Change: S56P

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
Pfam:TNFR_c6 44 66 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144524
SMART Domains Protein: ENSMUSP00000117470
Gene: ENSMUSG00000030341

DomainStartEndE-ValueType
TNFR 5 44 5.43e-6 SMART
TNFR 46 73 3.41e1 SMART
transmembrane domain 90 112 N/A INTRINSIC
low complexity region 141 154 N/A INTRINSIC
low complexity region 168 179 N/A INTRINSIC
Blast:DEATH 223 295 1e-13 BLAST
SCOP:d1icha_ 269 295 3e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 100% (64/64)
MGI Phenotype FUNCTION: This gene encodes a member of the TNF receptor superfamily of proteins. The encoded receptor is found in membrane-bound and soluble forms that interact with membrane-bound and soluble forms, respectively, of its ligand, tumor necrosis factor alpha. Binding of membrane-bound tumor necrosis factor alpha to the membrane-bound receptor induces receptor trimerization and activation, which plays a role in cell survival, apoptosis, and inflammation. Proteolytic processing of the encoded receptor results in release of the soluble form of the receptor, which can interact with free tumor necrosis factor alpha to inhibit inflammation. Mice lacking a functional copy of this gene exhibit impaired immune function. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit disrupted splenic architecture, increased adult liver weights, reduced IgG immune response, deficits in some host defense and inflammatory responses, LPS resistance, and reduced graft-vs-host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apcdd1 G T 18: 62,937,049 R129L probably damaging Het
Arhgef28 C T 13: 97,965,435 V844I probably damaging Het
Arhgef5 T C 6: 43,288,731 V1569A probably damaging Het
Atr T A 9: 95,866,694 S431T probably benign Het
Cdh11 T C 8: 102,634,321 D795G possibly damaging Het
Crygf T C 1: 65,927,971 S85P probably benign Het
Diexf A G 1: 193,114,855 I563T probably benign Het
Dip2c T A 13: 9,659,278 Y1385N probably damaging Het
Dnah14 G A 1: 181,626,944 V840I possibly damaging Het
Dsg1a T C 18: 20,328,738 F299L possibly damaging Het
Fgfr4 A T 13: 55,166,200 S576C probably damaging Het
Frmd8 T C 19: 5,869,518 D167G probably damaging Het
Gm5105 G A 3: 138,049,558 T89I unknown Het
Grhl1 C T 12: 24,575,997 S35L possibly damaging Het
Gsn A G 2: 35,293,506 E242G probably benign Het
Hcrtr1 A G 4: 130,135,868 I140T probably damaging Het
Ifnlr1 T C 4: 135,703,824 Y208H possibly damaging Het
Ighv1-58 T C 12: 115,312,365 Y51C probably damaging Het
Iqcj T A 3: 68,041,247 Y21* probably null Het
Kcnc4 T C 3: 107,458,862 Y10C probably benign Het
Kcnk7 G T 19: 5,706,132 G129W probably damaging Het
Kcnq2 T A 2: 181,081,724 R620* probably null Het
Klk13 C A 7: 43,726,702 P267Q probably benign Het
Krt1 AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC 15: 101,850,378 probably benign Het
L3mbtl4 G A 17: 68,486,943 R314H probably damaging Het
Lamc2 T A 1: 153,136,742 M729L probably benign Het
Lyst T G 13: 13,743,459 probably null Het
Med13l G A 5: 118,751,986 R1909H probably damaging Het
Mstn T A 1: 53,064,084 L193Q possibly damaging Het
Mylk T C 16: 35,000,426 V125A possibly damaging Het
Nalcn T A 14: 123,409,821 M547L probably damaging Het
Nckap5 A G 1: 126,025,048 S1256P probably damaging Het
Nkain1 T C 4: 130,532,118 Y189C probably damaging Het
Olfr1164 T A 2: 88,093,256 I227F probably benign Het
Olfr193 A G 16: 59,110,607 M1T probably null Het
Olfr490 T G 7: 108,286,344 I261L probably benign Het
Olfr761 A T 17: 37,952,502 I174N probably damaging Het
Oosp3 T A 19: 11,699,419 D47E probably benign Het
Pcdh15 G T 10: 74,466,354 G942W probably damaging Het
Pcyox1l C A 18: 61,707,554 probably benign Het
Peg3 T C 7: 6,708,839 E1128G possibly damaging Het
Pkd1l3 GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA 8: 109,624,195 probably benign Het
Plscr1 T A 9: 92,264,662 V119D probably damaging Het
Prss56 A T 1: 87,185,948 D258V possibly damaging Het
Ptpn23 T G 9: 110,385,816 K85Q possibly damaging Het
Ranbp3l C A 15: 9,007,285 S7Y probably benign Het
Rnf31 T C 14: 55,592,233 L85P probably damaging Het
Rptn T C 3: 93,397,900 C847R possibly damaging Het
Six4 T A 12: 73,108,953 E413D probably benign Het
Slc30a2 G A 4: 134,347,415 R161Q probably damaging Het
Sned1 T C 1: 93,284,421 V1115A probably damaging Het
Spen T C 4: 141,493,444 K401E unknown Het
Srbd1 T A 17: 86,136,415 R128W possibly damaging Het
Strc A T 2: 121,369,058 I1300N probably damaging Het
Susd1 T G 4: 59,390,627 T230P probably benign Het
Thumpd2 G T 17: 81,055,897 S47* probably null Het
Tmprss11a C T 5: 86,428,570 V141I probably damaging Het
Tmprss15 T C 16: 79,024,853 Y438C possibly damaging Het
Ttc39d T C 17: 80,216,181 W90R probably benign Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdr20rt A T 12: 65,225,762 probably null Het
Zfp646 C A 7: 127,882,322 Q1224K probably benign Het
Other mutations in Tnfrsf1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01987:Tnfrsf1a APN 6 125356864 missense probably damaging 1.00
IGL02468:Tnfrsf1a APN 6 125357861 missense probably benign 0.06
IGL02588:Tnfrsf1a APN 6 125360766 missense probably benign 0.44
R1302:Tnfrsf1a UTSW 6 125356916 missense probably damaging 1.00
R2189:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R4559:Tnfrsf1a UTSW 6 125360766 missense probably benign 0.44
R4794:Tnfrsf1a UTSW 6 125358084 missense probably damaging 1.00
R5039:Tnfrsf1a UTSW 6 125360712 missense possibly damaging 0.67
R5364:Tnfrsf1a UTSW 6 125357393 missense possibly damaging 0.87
R5792:Tnfrsf1a UTSW 6 125358077 missense probably damaging 1.00
R6742:Tnfrsf1a UTSW 6 125356948 missense probably damaging 0.99
R7128:Tnfrsf1a UTSW 6 125361536 missense probably benign 0.11
R7192:Tnfrsf1a UTSW 6 125361596 missense unknown
R7715:Tnfrsf1a UTSW 6 125361414 missense possibly damaging 0.65
R8745:Tnfrsf1a UTSW 6 125361782 missense probably damaging 0.99
R8755:Tnfrsf1a UTSW 6 125357805 missense probably benign 0.42
R8856:Tnfrsf1a UTSW 6 125357725 missense possibly damaging 0.85
R9005:Tnfrsf1a UTSW 6 125356915 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGCTACCTCTAAGGCCC -3'
(R):5'- CCAAGTAGGTTCCTGTAGATAGGG -3'

Sequencing Primer
(F):5'- TCTAAGGCCCCACCCCTG -3'
(R):5'- TTTAATCCCAGCACTCGGGAG -3'
Posted On 2019-05-13