Mutagenetix > Incidental Mutation

Incidental Mutation 'R7018:Dip2c'

545461

Institutional Source

Beutler Lab

Gene Symbol

Dip2c

Ensembl Gene

ENSMUSG00000048264

Gene Name

disco interacting protein 2 homolog C

Synonyms

2900024P20Rik

MMRRC Submission

Accession Numbers

Essential gene?

Possibly essential (E-score: 0.616) question?

Stock #

R7018 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

9276528-9668928 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 9659278 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Asparagine at position 1385 (Y1385N)

Ref Sequence

ENSEMBL: ENSMUSP00000133806 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000166299] [ENSMUST00000169960] [ENSMUST00000174552]

AlphaFold

E9PWR4

Predicted Effect

probably damaging
Transcript: ENSMUST00000166299
AA Change: Y1386N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000126827
Gene: ENSMUSG00000048264
AA Change: Y1386N

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	801	3.6e-23	PFAM
Pfam:AMP-binding	977	1451	1.5e-72	PFAM
low complexity region	1514	1526	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000169960
AA Change: Y1356N

PolyPhen 2 Score 0.923 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131238
Gene: ENSMUSG00000048264
AA Change: Y1356N

Domain	Start	End	E-Value	Type
DMAP_binding	7	176	3.02e-37	SMART
low complexity region	226	243	N/A	INTRINSIC
low complexity region	331	343	N/A	INTRINSIC
Pfam:AMP-binding	380	637	5.9e-10	PFAM
SCOP:d1lci__	675	875	2e-8	SMART
Pfam:AMP-binding	947	1421	1.2e-56	PFAM
low complexity region	1484	1496	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000174552
AA Change: Y1385N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133806
Gene: ENSMUSG00000048264
AA Change: Y1385N

Domain	Start	End	E-Value	Type
DMAP_binding	7	120	3.55e-43	SMART
low complexity region	170	187	N/A	INTRINSIC
low complexity region	275	287	N/A	INTRINSIC
Pfam:AMP-binding	324	800	2.7e-20	PFAM
Pfam:AMP-binding	976	1450	1.3e-56	PFAM
low complexity region	1513	1525	N/A	INTRINSIC

Predicted Effect

Meta Mutation Damage Score

0.8890

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (64/64)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 family. The protein shares strong similarity with a Drosophila protein which interacts with the transcription factor disco and is expressed in the nervous system. [provided by RefSeq, Oct 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Apcdd1	G	T	18: 62,937,049	R129L	probably damaging	Het
Arhgef28	C	T	13: 97,965,435	V844I	probably damaging	Het
Arhgef5	T	C	6: 43,288,731	V1569A	probably damaging	Het
Atr	T	A	9: 95,866,694	S431T	probably benign	Het
Cdh11	T	C	8: 102,634,321	D795G	possibly damaging	Het
Crygf	T	C	1: 65,927,971	S85P	probably benign	Het
Diexf	A	G	1: 193,114,855	I563T	probably benign	Het
Dnah14	G	A	1: 181,626,944	V840I	possibly damaging	Het
Dsg1a	T	C	18: 20,328,738	F299L	possibly damaging	Het
Fgfr4	A	T	13: 55,166,200	S576C	probably damaging	Het
Frmd8	T	C	19: 5,869,518	D167G	probably damaging	Het
Gm5105	G	A	3: 138,049,558	T89I	unknown	Het
Grhl1	C	T	12: 24,575,997	S35L	possibly damaging	Het
Gsn	A	G	2: 35,293,506	E242G	probably benign	Het
Hcrtr1	A	G	4: 130,135,868	I140T	probably damaging	Het
Ifnlr1	T	C	4: 135,703,824	Y208H	possibly damaging	Het
Ighv1-58	T	C	12: 115,312,365	Y51C	probably damaging	Het
Iqcj	T	A	3: 68,041,247	Y21*	probably null	Het
Kcnc4	T	C	3: 107,458,862	Y10C	probably benign	Het
Kcnk7	G	T	19: 5,706,132	G129W	probably damaging	Het
Kcnq2	T	A	2: 181,081,724	R620*	probably null	Het
Klk13	C	A	7: 43,726,702	P267Q	probably benign	Het
Krt1	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	AAGCTGCCACCCCCAAAGCCACCACCGCCGTAGCTGCCACCCCCAAAGCCACCAC	15: 101,850,378		probably benign	Het
L3mbtl4	G	A	17: 68,486,943	R314H	probably damaging	Het
Lamc2	T	A	1: 153,136,742	M729L	probably benign	Het
Lyst	T	G	13: 13,743,459		probably null	Het
Med13l	G	A	5: 118,751,986	R1909H	probably damaging	Het
Mstn	T	A	1: 53,064,084	L193Q	possibly damaging	Het
Mylk	T	C	16: 35,000,426	V125A	possibly damaging	Het
Nalcn	T	A	14: 123,409,821	M547L	probably damaging	Het
Nckap5	A	G	1: 126,025,048	S1256P	probably damaging	Het
Nkain1	T	C	4: 130,532,118	Y189C	probably damaging	Het
Olfr1164	T	A	2: 88,093,256	I227F	probably benign	Het
Olfr193	A	G	16: 59,110,607	M1T	probably null	Het
Olfr490	T	G	7: 108,286,344	I261L	probably benign	Het
Olfr761	A	T	17: 37,952,502	I174N	probably damaging	Het
Oosp3	T	A	19: 11,699,419	D47E	probably benign	Het
Pcdh15	G	T	10: 74,466,354	G942W	probably damaging	Het
Pcyox1l	C	A	18: 61,707,554		probably benign	Het
Peg3	T	C	7: 6,708,839	E1128G	possibly damaging	Het
Pkd1l3	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	GACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCAACAAACATGACATCAGACACACCTGCATCCAGCAGCCCA	8: 109,624,195		probably benign	Het
Plscr1	T	A	9: 92,264,662	V119D	probably damaging	Het
Prss56	A	T	1: 87,185,948	D258V	possibly damaging	Het
Ptpn23	T	G	9: 110,385,816	K85Q	possibly damaging	Het
Ranbp3l	C	A	15: 9,007,285	S7Y	probably benign	Het
Rnf31	T	C	14: 55,592,233	L85P	probably damaging	Het
Rptn	T	C	3: 93,397,900	C847R	possibly damaging	Het
Six4	T	A	12: 73,108,953	E413D	probably benign	Het
Slc30a2	G	A	4: 134,347,415	R161Q	probably damaging	Het
Sned1	T	C	1: 93,284,421	V1115A	probably damaging	Het
Spen	T	C	4: 141,493,444	K401E	unknown	Het
Srbd1	T	A	17: 86,136,415	R128W	possibly damaging	Het
Strc	A	T	2: 121,369,058	I1300N	probably damaging	Het
Susd1	T	G	4: 59,390,627	T230P	probably benign	Het
Thumpd2	G	T	17: 81,055,897	S47*	probably null	Het
Tmprss11a	C	T	5: 86,428,570	V141I	probably damaging	Het
Tmprss15	T	C	16: 79,024,853	Y438C	possibly damaging	Het
Tnfrsf1a	T	C	6: 125,356,951	S56P	probably damaging	Het
Ttc39d	T	C	17: 80,216,181	W90R	probably benign	Het
Vmn2r111	T	C	17: 22,559,051	N549S	possibly damaging	Het
Wdr20rt	A	T	12: 65,225,762		probably null	Het
Zfp646	C	A	7: 127,882,322	Q1224K	probably benign	Het

Other mutations in Dip2c

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00392:Dip2c	APN	13	9493108	missense	probably damaging	0.97
IGL00426:Dip2c	APN	13	9606515	missense	probably damaging	1.00
IGL00503:Dip2c	APN	13	9567898	missense	probably damaging	1.00
IGL00586:Dip2c	APN	13	9610755	missense	probably damaging	1.00
IGL01306:Dip2c	APN	13	9575143	missense	possibly damaging	0.72
IGL01580:Dip2c	APN	13	9637088	splice site	probably null
IGL01985:Dip2c	APN	13	9553267	splice site	probably benign
IGL02060:Dip2c	APN	13	9622630	missense	probably damaging	0.98
IGL02122:Dip2c	APN	13	9506659	missense	possibly damaging	0.48
IGL02170:Dip2c	APN	13	9606335	missense	probably benign	0.03
IGL02211:Dip2c	APN	13	9610847	missense	probably damaging	1.00
IGL02755:Dip2c	APN	13	9550320	critical splice donor site	probably null
IGL02836:Dip2c	APN	13	9610790	missense	probably damaging	0.98
IGL02935:Dip2c	APN	13	9662146	missense	probably damaging	1.00
IGL03032:Dip2c	APN	13	9551778	missense	probably damaging	1.00
ANU23:Dip2c	UTSW	13	9575143	missense	possibly damaging	0.72
P0038:Dip2c	UTSW	13	9646982	missense	probably damaging	1.00
R0009:Dip2c	UTSW	13	9621903	missense	probably damaging	1.00
R0268:Dip2c	UTSW	13	9637150	missense	probably damaging	1.00
R0271:Dip2c	UTSW	13	9615775	missense	probably damaging	1.00
R0306:Dip2c	UTSW	13	9604599	missense	probably benign	0.09
R0415:Dip2c	UTSW	13	9568289	splice site	probably benign
R0519:Dip2c	UTSW	13	9563208	missense	probably damaging	1.00
R0557:Dip2c	UTSW	13	9553459	missense	possibly damaging	0.81
R0964:Dip2c	UTSW	13	9568663	missense	probably benign	0.43
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0973:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R0974:Dip2c	UTSW	13	9576908	missense	probably damaging	0.99
R1101:Dip2c	UTSW	13	9634744	missense	probably damaging	1.00
R1171:Dip2c	UTSW	13	9493126	missense	possibly damaging	0.89
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1403:Dip2c	UTSW	13	9553264	splice site	probably null
R1432:Dip2c	UTSW	13	9553304	missense	probably damaging	0.99
R1481:Dip2c	UTSW	13	9551866	critical splice donor site	probably null
R1588:Dip2c	UTSW	13	9665864	missense	probably damaging	1.00
R1721:Dip2c	UTSW	13	9659368	missense	probably damaging	1.00
R1726:Dip2c	UTSW	13	9575428	missense	probably damaging	1.00
R1867:Dip2c	UTSW	13	9621949	missense	possibly damaging	0.55
R1909:Dip2c	UTSW	13	9533350	missense	probably benign	0.00
R2013:Dip2c	UTSW	13	9567846	nonsense	probably null
R2022:Dip2c	UTSW	13	9551800	missense	probably damaging	1.00
R2517:Dip2c	UTSW	13	9609005	missense	probably damaging	1.00
R3746:Dip2c	UTSW	13	9601473	missense	probably damaging	1.00
R3794:Dip2c	UTSW	13	9604561	missense	probably damaging	0.99
R3884:Dip2c	UTSW	13	9551858	missense	probably damaging	1.00
R4019:Dip2c	UTSW	13	9614365	missense	probably damaging	0.99
R4110:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4111:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4113:Dip2c	UTSW	13	9637101	missense	probably damaging	1.00
R4256:Dip2c	UTSW	13	9609056	missense	probably damaging	1.00
R4300:Dip2c	UTSW	13	9610711	missense	probably damaging	1.00
R4494:Dip2c	UTSW	13	9571062	missense	possibly damaging	0.64
R4739:Dip2c	UTSW	13	9533339	missense	probably damaging	0.98
R4812:Dip2c	UTSW	13	9637130	nonsense	probably null
R4814:Dip2c	UTSW	13	9536860	missense	probably benign	0.07
R4816:Dip2c	UTSW	13	9575150	missense	probably benign	0.37
R4828:Dip2c	UTSW	13	9560679	missense	probably damaging	1.00
R4915:Dip2c	UTSW	13	9621869	splice site	probably null
R4917:Dip2c	UTSW	13	9621869	splice site	probably null
R4932:Dip2c	UTSW	13	9623972	missense	probably damaging	0.99
R4993:Dip2c	UTSW	13	9575223	nonsense	probably null
R5043:Dip2c	UTSW	13	9551827	missense	possibly damaging	0.80
R5349:Dip2c	UTSW	13	9622653	missense	probably damaging	1.00
R5744:Dip2c	UTSW	13	9568405	missense	probably damaging	1.00
R5840:Dip2c	UTSW	13	9506676	missense	possibly damaging	0.68
R6110:Dip2c	UTSW	13	9623766	missense	probably damaging	1.00
R6160:Dip2c	UTSW	13	9533254	missense	probably benign	0.01
R6161:Dip2c	UTSW	13	9647007	missense	probably damaging	1.00
R6477:Dip2c	UTSW	13	9623760	missense	probably damaging	1.00
R6522:Dip2c	UTSW	13	9575228	critical splice donor site	probably null
R6603:Dip2c	UTSW	13	9654588	splice site	probably null
R6658:Dip2c	UTSW	13	9493177	critical splice donor site	probably null
R6672:Dip2c	UTSW	13	9567830	critical splice acceptor site	probably null
R6697:Dip2c	UTSW	13	9621913	missense	probably damaging	1.00
R6991:Dip2c	UTSW	13	9551860	nonsense	probably null
R6991:Dip2c	UTSW	13	9634832	missense	probably damaging	1.00
R7053:Dip2c	UTSW	13	9610704	missense	probably damaging	1.00
R7102:Dip2c	UTSW	13	9604536	missense	probably benign	0.01
R7171:Dip2c	UTSW	13	9506648	missense	probably benign	0.34
R7371:Dip2c	UTSW	13	9592749	missense	probably benign	0.02
R7395:Dip2c	UTSW	13	9614377	missense	probably damaging	1.00
R7489:Dip2c	UTSW	13	9533312	missense	probably damaging	0.99
R7575:Dip2c	UTSW	13	9628012	missense	probably damaging	0.97
R7642:Dip2c	UTSW	13	9622705	critical splice donor site	probably null
R7687:Dip2c	UTSW	13	9604581	missense	probably benign	0.00
R7699:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7700:Dip2c	UTSW	13	9659311	missense	probably benign	0.00
R7715:Dip2c	UTSW	13	9614391	missense	probably damaging	1.00
R7842:Dip2c	UTSW	13	9606533	critical splice donor site	probably null
R7845:Dip2c	UTSW	13	9609044	missense	probably damaging	1.00
R8354:Dip2c	UTSW	13	9621882	missense	probably benign	0.05
R8685:Dip2c	UTSW	13	9637125	missense	probably benign	0.01
R8779:Dip2c	UTSW	13	9610809	missense	probably damaging	0.98
R8786:Dip2c	UTSW	13	9615794	missense	probably damaging	0.99
R8815:Dip2c	UTSW	13	9623798	nonsense	probably null
R8833:Dip2c	UTSW	13	9575483	critical splice donor site	probably null
R8868:Dip2c	UTSW	13	9575467	missense	possibly damaging	0.73
R8873:Dip2c	UTSW	13	9575146	missense	probably benign	0.03
R8887:Dip2c	UTSW	13	9623953	splice site	probably benign
R8923:Dip2c	UTSW	13	9623865	missense	probably damaging	1.00
R9112:Dip2c	UTSW	13	9610730	missense	probably damaging	1.00
R9424:Dip2c	UTSW	13	9659395	missense	probably damaging	1.00
R9474:Dip2c	UTSW	13	9494927	missense	unknown
R9527:Dip2c	UTSW	13	9494839	missense	unknown
R9593:Dip2c	UTSW	13	9654647	missense	possibly damaging	0.89
R9615:Dip2c	UTSW	13	9575155	missense	probably benign	0.03
R9801:Dip2c	UTSW	13	9576900	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GTCTTGTATTTGAACTGAACCAAGG -3'
(R):5'- TGGCTCTCAACCTCAAAGCC -3'

Sequencing Primer
(F):5'- CCAAGGAAGCCTTAGTCATTGTG -3'
(R):5'- ACCTCAAAGCCATTTTCAGTGTCAG -3'

Posted On

2019-05-13