Incidental Mutation 'R7106:Clca1'
ID551161
Institutional Source Beutler Lab
Gene Symbol Clca1
Ensembl Gene ENSMUSG00000028255
Gene Namechloride channel accessory 1
Synonymsgob-5, gob5, Clca3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.113) question?
Stock #R7106 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location145003817-145032776 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 145027429 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 106 (V106A)
Ref Sequence ENSEMBL: ENSMUSP00000029919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029919]
Predicted Effect probably damaging
Transcript: ENSMUST00000029919
AA Change: V106A

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000029919
Gene: ENSMUSG00000028255
AA Change: V106A

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 285 297 N/A INTRINSIC
VWA 305 478 5.05e-19 SMART
Blast:FN3 753 852 2e-28 BLAST
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (62/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium sensitive chloride conductance protein family. To date, all members of this gene family map to the same region on chromosome 1p31-p22 and share a high degree of homology in size, sequence, and predicted structure, but differ significantly in their tissue distributions. The encoded protein is expressed as a precursor protein that is processed into two cell-surface-associated subunits, although the site at which the precursor is cleaved has not been precisely determined. The encoded protein may be involved in mediating calcium-activated chloride conductance in the intestine. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit an exacerbated mucin response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 63 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldob T C 4: 49,541,258 Y138C probably damaging Het
Ano7 A C 1: 93,374,983 probably null Het
Arvcf T A 16: 18,399,049 V497E probably damaging Het
Atad2 A G 15: 58,116,766 probably null Het
Brinp1 C T 4: 68,829,378 A163T probably benign Het
Catsperd C A 17: 56,658,070 probably null Het
Ccm2l A G 2: 153,070,651 H70R possibly damaging Het
Cgnl1 G A 9: 71,725,733 T112I probably benign Het
Chid1 T C 7: 141,522,660 H220R probably benign Het
Cldn23 A C 8: 35,825,915 S140A probably benign Het
Dennd2c T C 3: 103,131,577 S14P possibly damaging Het
Det1 T C 7: 78,843,464 D264G probably damaging Het
Dmwd T C 7: 19,080,529 V368A probably damaging Het
Dnah11 T C 12: 117,961,149 K3362E probably benign Het
Dnah8 T C 17: 30,741,178 F2208L probably damaging Het
Dnaja3 T C 16: 4,705,934 I477T probably benign Het
Dnmt3a A G 12: 3,897,591 K482E probably damaging Het
Dock7 A G 4: 98,967,326 I1493T unknown Het
Ehbp1l1 A G 19: 5,718,737 V846A probably benign Het
Fbxl4 T A 4: 22,427,140 probably null Het
Fgd2 T A 17: 29,376,970 L534* probably null Het
Fgfr3 T C 5: 33,731,414 V349A probably damaging Het
Gal3st1 A T 11: 3,998,509 I239F probably damaging Het
Gpatch3 C A 4: 133,578,203 H250N probably benign Het
Guca1b A T 17: 47,391,311 K230* probably null Het
Itga3 G T 11: 95,055,873 L737I probably benign Het
Kmt5c A G 7: 4,742,706 K122E probably damaging Het
Kpna4 G A 3: 69,079,464 Q531* probably null Het
Lctl A G 9: 64,132,837 E410G probably benign Het
Lhx1 T C 11: 84,522,077 N128D probably benign Het
Lifr A G 15: 7,172,924 N349D probably benign Het
Map2 G A 1: 66,410,744 A209T possibly damaging Het
Mif4gd G A 11: 115,611,911 A25V probably damaging Het
Mug2 T C 6: 122,082,721 S1353P probably damaging Het
Myh9 A G 15: 77,775,121 C931R probably benign Het
Nelfe T G 17: 34,852,419 probably null Het
Nrf1 A G 6: 30,102,184 S161G probably benign Het
Pik3c2a G A 7: 116,418,133 Q130* probably null Het
Prex2 T A 1: 11,136,793 M525K probably benign Het
Psme2 A G 14: 55,588,237 S165P probably benign Het
Rapgef2 A G 3: 79,066,608 F1477S probably benign Het
Rasef A T 4: 73,727,627 C502S probably damaging Het
Rpap2 T A 5: 107,633,122 L565* probably null Het
Sav1 A G 12: 69,984,616 I44T probably damaging Het
Selp T A 1: 164,126,422 I97N probably benign Het
Serpina1d A G 12: 103,765,721 F293S probably benign Het
Sin3b T C 8: 72,724,137 F65L possibly damaging Het
Sorcs3 G C 19: 48,705,963 G559R probably damaging Het
Susd2 A T 10: 75,638,053 D689E probably damaging Het
Tas1r2 A T 4: 139,662,049 M448L probably benign Het
Tbc1d30 A T 10: 121,301,992 I181N possibly damaging Het
Tcea3 A G 4: 136,271,368 T318A probably damaging Het
Tomm70a T C 16: 57,140,758 V358A probably damaging Het
Tpp1 A C 7: 105,749,911 S153A possibly damaging Het
Trip13 C T 13: 73,914,532 V387I probably benign Het
Ttn T C 2: 76,797,488 I14704V probably benign Het
Uimc1 C A 13: 55,050,815 C516F possibly damaging Het
Vit A G 17: 78,586,799 N210S probably benign Het
Vmn1r22 G T 6: 57,900,311 T227K probably damaging Het
Vmn2r5 A G 3: 64,491,683 I625T probably benign Het
Zfp27 AATCCGCTTGTGCA AA 7: 29,895,021 probably benign Het
Zfp384 T C 6: 125,024,259 L98P probably benign Het
Zfp809 G T 9: 22,236,224 K51N probably benign Het
Other mutations in Clca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00664:Clca1 APN 3 145027899 missense probably benign 0.01
IGL00862:Clca1 APN 3 145024571 missense possibly damaging 0.89
IGL00895:Clca1 APN 3 145024596 missense probably damaging 1.00
IGL00969:Clca1 APN 3 145008958 missense possibly damaging 0.80
IGL01398:Clca1 APN 3 145016751 missense possibly damaging 0.81
IGL01447:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01455:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01457:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01458:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01462:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01473:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01488:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01490:Clca1 APN 3 145007778 missense probably benign 0.00
IGL01632:Clca1 APN 3 145027441 missense probably damaging 1.00
IGL01896:Clca1 APN 3 145015677 missense possibly damaging 0.79
IGL02411:Clca1 APN 3 145028002 missense possibly damaging 0.89
IGL03156:Clca1 APN 3 145013911 missense probably damaging 1.00
R0472:Clca1 UTSW 3 145027345 missense probably damaging 1.00
R0571:Clca1 UTSW 3 145007789 missense probably damaging 1.00
R0585:Clca1 UTSW 3 145032625 missense probably benign 0.16
R0586:Clca1 UTSW 3 145032589 missense probably benign 0.45
R0791:Clca1 UTSW 3 145004854 missense probably benign 0.01
R1187:Clca1 UTSW 3 145009743 missense probably benign 0.30
R1713:Clca1 UTSW 3 145024546 missense probably benign 0.00
R1739:Clca1 UTSW 3 145007778 missense probably benign 0.00
R2079:Clca1 UTSW 3 145007773 missense possibly damaging 0.80
R2129:Clca1 UTSW 3 145016765 missense probably damaging 1.00
R2178:Clca1 UTSW 3 145006102 missense probably damaging 1.00
R2234:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2235:Clca1 UTSW 3 145009068 missense possibly damaging 0.93
R2240:Clca1 UTSW 3 145008985 missense probably damaging 1.00
R3751:Clca1 UTSW 3 145018663 missense probably benign 0.01
R3974:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R3975:Clca1 UTSW 3 145032639 missense probably damaging 1.00
R4409:Clca1 UTSW 3 145006027 missense probably damaging 1.00
R4586:Clca1 UTSW 3 145016858 missense probably damaging 1.00
R4751:Clca1 UTSW 3 145004848 missense possibly damaging 0.89
R4894:Clca1 UTSW 3 145013901 missense probably damaging 0.99
R4909:Clca1 UTSW 3 145024563 missense probably damaging 1.00
R4916:Clca1 UTSW 3 145015844 missense probably benign 0.01
R4941:Clca1 UTSW 3 145015653 missense probably damaging 1.00
R4942:Clca1 UTSW 3 145004763 missense probably benign 0.02
R5044:Clca1 UTSW 3 145007928 splice site probably null
R5451:Clca1 UTSW 3 145027986 missense probably damaging 1.00
R5618:Clca1 UTSW 3 145004977 missense probably benign 0.00
R5724:Clca1 UTSW 3 145009072 missense probably benign 0.01
R5898:Clca1 UTSW 3 145016761 missense possibly damaging 0.89
R6238:Clca1 UTSW 3 145008955 missense probably benign 0.09
R6590:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6591:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6592:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6690:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6691:Clca1 UTSW 3 145013883 missense probably damaging 1.00
R6729:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R6805:Clca1 UTSW 3 145018667 missense probably damaging 1.00
R7121:Clca1 UTSW 3 145011806 missense probably damaging 1.00
R7127:Clca1 UTSW 3 145006045 missense probably damaging 1.00
R7212:Clca1 UTSW 3 145005966 missense probably damaging 1.00
R7444:Clca1 UTSW 3 145027432 missense probably damaging 1.00
R7446:Clca1 UTSW 3 145027427 missense possibly damaging 0.65
R7535:Clca1 UTSW 3 145018567 missense probably damaging 0.99
R8437:Clca1 UTSW 3 145005061 missense probably benign 0.00
X0020:Clca1 UTSW 3 145032660 missense possibly damaging 0.89
Z1176:Clca1 UTSW 3 145013921 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTACTGCAATTGCCTGGCAC -3'
(R):5'- TTGGTCAATTGCTCAGTTGC -3'

Sequencing Primer
(F):5'- ACTGCAATTGCCTGGCACTATAG -3'
(R):5'- CAATTGCTCAGTTGCTTGGTTGTTC -3'
Posted On2019-05-15