Incidental Mutation 'R7151:Tiam2'
ID554161
Institutional Source Beutler Lab
Gene Symbol Tiam2
Ensembl Gene ENSMUSG00000023800
Gene NameT cell lymphoma invasion and metastasis 2
Synonyms3000002F19Rik, STEF
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7151 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location3326573-3531344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3448385 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 812 (D812G)
Ref Sequence ENSEMBL: ENSMUSP00000072020 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072156] [ENSMUST00000169838]
PDB Structure
Crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Low-resolution crystal structure of the Tiam2 PHCCEx domain [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000072156
AA Change: D812G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000072020
Gene: ENSMUSG00000023800
AA Change: D812G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169838
AA Change: D812G

PolyPhen 2 Score 0.363 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000125842
Gene: ENSMUSG00000023800
AA Change: D812G

DomainStartEndE-ValueType
low complexity region 230 245 N/A INTRINSIC
low complexity region 267 281 N/A INTRINSIC
low complexity region 471 492 N/A INTRINSIC
PH 505 620 7.82e-16 SMART
RBD 831 902 1.32e-26 SMART
PDZ 921 995 2.38e-7 SMART
RhoGEF 1124 1313 2.23e-61 SMART
PH 1347 1478 2.86e0 SMART
low complexity region 1522 1532 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a guanine nucleotide exchange factor. A highly similar mouse protein specifically activates ras-related C3 botulinum substrate 1, converting this Rho-like guanosine triphosphatase (GTPase) from a guanosine diphosphate-bound inactive state to a guanosine triphosphate-bound active state. The encoded protein may play a role in neural cell development. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
6330409D20Rik T A 2: 32,740,606 Q52L unknown Het
Acsl1 A G 8: 46,513,597 D202G probably damaging Het
Adam3 A T 8: 24,695,255 C476S probably damaging Het
Adam34 T A 8: 43,651,462 E382V probably benign Het
Akap5 G A 12: 76,328,249 V152I probably benign Het
Aldh5a1 C T 13: 24,937,399 W57* probably null Het
Angptl2 C T 2: 33,243,910 Q415* probably null Het
Bnc1 G T 7: 81,973,307 T724N possibly damaging Het
Brca2 T C 5: 150,541,436 V1555A probably benign Het
Btn1a1 T A 13: 23,459,313 D322V probably damaging Het
Chsy3 T A 18: 59,409,285 D498E possibly damaging Het
Ddx24 T C 12: 103,424,088 T215A probably benign Het
Dhx57 A T 17: 80,273,047 V492E probably damaging Het
Dnhd1 G A 7: 105,710,027 R3523Q probably benign Het
Dock3 T A 9: 106,964,717 D971V possibly damaging Het
Ercc8 T C 13: 108,187,282 probably null Het
Erich5 T A 15: 34,470,949 L108Q probably damaging Het
F5 A T 1: 164,201,661 Y1743F probably damaging Het
Fam196a A C 7: 134,918,645 I52S probably damaging Het
Gale T C 4: 135,967,192 V243A probably damaging Het
Gspt1 T A 16: 11,253,828 Q57L probably benign Het
Gtf3a C A 5: 146,951,275 Q129K probably benign Het
Heyl T C 4: 123,246,461 V271A probably benign Het
Hsd17b4 T C 18: 50,128,370 F7L probably damaging Het
Hspa12a T C 19: 58,822,162 T150A probably benign Het
Ift140 T A 17: 25,055,725 D790E probably damaging Het
Igkv4-69 T A 6: 69,283,933 Y70F probably damaging Het
Il1rap T C 16: 26,712,128 Y405H probably damaging Het
Irf2bpl G T 12: 86,883,353 P182Q probably benign Het
Itm2b C A 14: 73,368,389 probably benign Het
Kcnc2 T C 10: 112,458,509 V106A possibly damaging Het
Krt83 C A 15: 101,489,648 D170Y probably damaging Het
Lca5 T A 9: 83,398,640 Y369F probably benign Het
Mgat5 T A 1: 127,446,262 D466E probably damaging Het
Mier3 C T 13: 111,714,768 P428L probably benign Het
Myo6 T C 9: 80,245,136 Y167H unknown Het
Neu2 A G 1: 87,596,575 E94G probably benign Het
Nlrp9a A T 7: 26,557,247 K97* probably null Het
Npdc1 A G 2: 25,409,108 M306V probably damaging Het
Odf2l A T 3: 145,127,066 N95I probably benign Het
Olfr1101 A G 2: 86,989,041 V45A probably benign Het
Olfr218 A G 1: 173,204,066 K237E probably damaging Het
Olfr270 G T 4: 52,970,665 V15L probably benign Het
Olfr836 A G 9: 19,121,741 Y259C possibly damaging Het
P2ry12 A G 3: 59,217,706 F183L probably benign Het
Proser3 A G 7: 30,540,324 F452L possibly damaging Het
Ptgfrn G T 3: 101,080,195 Y117* probably null Het
Rab3gap2 G T 1: 185,248,053 V360F probably benign Het
Rp1l1 A T 14: 64,029,026 D687V possibly damaging Het
Rxfp2 T G 5: 150,043,107 N103K probably benign Het
Scfd2 T A 5: 74,397,665 Q517L possibly damaging Het
Scnn1b G A 7: 121,917,886 A582T probably damaging Het
Serpinb6e T C 13: 33,837,835 E170G probably damaging Het
Serpinb8 T A 1: 107,605,797 V194E probably damaging Het
Sgcz T A 8: 37,539,679 H191L possibly damaging Het
Sirt1 A T 10: 63,323,996 L435Q probably damaging Het
Sorcs1 G A 19: 50,312,982 P315S probably damaging Het
Spdef T A 17: 27,720,160 S71C possibly damaging Het
Spta1 T A 1: 174,197,751 H727Q probably damaging Het
Srsf1 C T 11: 88,049,258 Q199* probably null Het
Stard9 A T 2: 120,696,142 D960V probably benign Het
Tcp10c A T 17: 13,355,904 I49F possibly damaging Het
Tgm2 T C 2: 158,129,395 N308S possibly damaging Het
Tph1 A T 7: 46,662,117 V67D possibly damaging Het
Trps1 C T 15: 50,822,397 R794H possibly damaging Het
Ttn C T 2: 76,853,161 A906T Het
Vmn1r124 G A 7: 21,260,259 P120L probably benign Het
Vmn2r92 A T 17: 18,166,743 T115S probably benign Het
Wdr11 A G 7: 129,606,652 D377G probably damaging Het
Wdr55 G T 18: 36,762,936 A251S possibly damaging Het
Zbtb7b C T 3: 89,380,902 R203H probably benign Het
Zfp109 A T 7: 24,229,806 H67Q probably benign Het
Zfp462 G A 4: 55,051,271 C2248Y probably damaging Het
Zyg11b T C 4: 108,244,922 H534R possibly damaging Het
Other mutations in Tiam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Tiam2 APN 17 3415028 missense probably benign 0.21
IGL01320:Tiam2 APN 17 3505745 missense probably damaging 1.00
IGL01384:Tiam2 APN 17 3427202 missense probably benign 0.08
IGL01575:Tiam2 APN 17 3454316 missense probably damaging 1.00
IGL01769:Tiam2 APN 17 3427290 missense probably damaging 1.00
IGL02395:Tiam2 APN 17 3421481 missense possibly damaging 0.49
IGL02652:Tiam2 APN 17 3439696 splice site probably benign
IGL03102:Tiam2 APN 17 3509548 missense probably damaging 1.00
IGL03222:Tiam2 APN 17 3438708 missense probably damaging 0.97
Feste_burg UTSW 17 3414622 frame shift probably null
R0257:Tiam2 UTSW 17 3450813 missense possibly damaging 0.49
R0420:Tiam2 UTSW 17 3502918 missense probably benign 0.01
R0528:Tiam2 UTSW 17 3511071 missense probably damaging 1.00
R0532:Tiam2 UTSW 17 3421646 missense probably damaging 1.00
R0551:Tiam2 UTSW 17 3428954 missense probably damaging 1.00
R0554:Tiam2 UTSW 17 3438681 nonsense probably null
R0645:Tiam2 UTSW 17 3514698 missense possibly damaging 0.92
R0726:Tiam2 UTSW 17 3512833 unclassified probably benign
R1139:Tiam2 UTSW 17 3477267 missense possibly damaging 0.55
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1392:Tiam2 UTSW 17 3414197 missense possibly damaging 0.71
R1529:Tiam2 UTSW 17 3516703 missense probably benign 0.00
R1671:Tiam2 UTSW 17 3506834 missense probably damaging 1.00
R1731:Tiam2 UTSW 17 3518423 missense probably damaging 0.98
R1759:Tiam2 UTSW 17 3516003 missense probably damaging 0.98
R1850:Tiam2 UTSW 17 3437235 missense probably damaging 1.00
R1853:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1855:Tiam2 UTSW 17 3415135 missense probably damaging 1.00
R1931:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1932:Tiam2 UTSW 17 3514725 missense possibly damaging 0.68
R1993:Tiam2 UTSW 17 3415126 nonsense probably null
R2211:Tiam2 UTSW 17 3414918 nonsense probably null
R2217:Tiam2 UTSW 17 3415114 missense probably benign 0.34
R2278:Tiam2 UTSW 17 3427220 missense probably damaging 0.96
R2407:Tiam2 UTSW 17 3477261 missense probably benign 0.14
R2516:Tiam2 UTSW 17 3453382 missense probably damaging 1.00
R2991:Tiam2 UTSW 17 3518250 missense probably benign
R3086:Tiam2 UTSW 17 3421582 missense probably damaging 1.00
R3121:Tiam2 UTSW 17 3439702 missense probably benign 0.01
R3686:Tiam2 UTSW 17 3421684 missense possibly damaging 0.87
R3740:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3742:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R3826:Tiam2 UTSW 17 3507701 splice site probably benign
R3829:Tiam2 UTSW 17 3507701 splice site probably benign
R3844:Tiam2 UTSW 17 3421651 missense probably damaging 0.98
R3970:Tiam2 UTSW 17 3428831 missense probably damaging 1.00
R4060:Tiam2 UTSW 17 3428980 missense probably benign 0.00
R4296:Tiam2 UTSW 17 3450845 missense probably benign
R4357:Tiam2 UTSW 17 3450853 missense probably damaging 1.00
R4368:Tiam2 UTSW 17 3414683 missense probably benign 0.01
R4369:Tiam2 UTSW 17 3413967 start gained probably benign
R4524:Tiam2 UTSW 17 3514711 missense probably damaging 1.00
R4619:Tiam2 UTSW 17 3518342 missense probably damaging 1.00
R4715:Tiam2 UTSW 17 3454168 missense probably damaging 1.00
R4723:Tiam2 UTSW 17 3450317 missense probably benign 0.00
R4979:Tiam2 UTSW 17 3505710 missense probably damaging 1.00
R5182:Tiam2 UTSW 17 3438721 missense probably damaging 1.00
R5451:Tiam2 UTSW 17 3428996 missense probably damaging 1.00
R5728:Tiam2 UTSW 17 3414956 missense probably damaging 0.99
R5827:Tiam2 UTSW 17 3448489 missense probably benign 0.00
R5879:Tiam2 UTSW 17 3437265 missense probably damaging 1.00
R5960:Tiam2 UTSW 17 3438640 missense probably benign 0.24
R5974:Tiam2 UTSW 17 3414809 missense possibly damaging 0.51
R6198:Tiam2 UTSW 17 3414121 missense probably benign 0.06
R6222:Tiam2 UTSW 17 3453338 missense probably damaging 0.96
R6295:Tiam2 UTSW 17 3509556 missense probably damaging 1.00
R6355:Tiam2 UTSW 17 3414622 frame shift probably null
R6356:Tiam2 UTSW 17 3414622 frame shift probably null
R6454:Tiam2 UTSW 17 3438663 missense probably benign 0.00
R6497:Tiam2 UTSW 17 3506827 missense probably damaging 1.00
R6579:Tiam2 UTSW 17 3414622 frame shift probably null
R6580:Tiam2 UTSW 17 3414622 frame shift probably null
R6581:Tiam2 UTSW 17 3414622 frame shift probably null
R6582:Tiam2 UTSW 17 3414622 frame shift probably null
R6648:Tiam2 UTSW 17 3506873 missense probably damaging 1.00
R6705:Tiam2 UTSW 17 3518243 missense probably benign 0.01
R6758:Tiam2 UTSW 17 3518403 missense probably benign 0.01
R6836:Tiam2 UTSW 17 3414380 missense probably benign 0.17
R6924:Tiam2 UTSW 17 3507795 missense probably damaging 1.00
R6977:Tiam2 UTSW 17 3518659 missense probably damaging 1.00
R7051:Tiam2 UTSW 17 3448483 missense probably damaging 0.99
R7214:Tiam2 UTSW 17 3518412 missense possibly damaging 0.85
R7332:Tiam2 UTSW 17 3453369 missense probably damaging 1.00
R7334:Tiam2 UTSW 17 3503008 missense possibly damaging 0.92
R7414:Tiam2 UTSW 17 3414113 missense possibly damaging 0.54
R7660:Tiam2 UTSW 17 3482605 start codon destroyed probably null 0.66
R7743:Tiam2 UTSW 17 3518156 missense possibly damaging 0.53
R7755:Tiam2 UTSW 17 3421316 missense probably benign 0.01
R7805:Tiam2 UTSW 17 3509410 missense probably damaging 1.00
R7813:Tiam2 UTSW 17 3437247 missense probably damaging 1.00
R7842:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R7925:Tiam2 UTSW 17 3518124 missense possibly damaging 0.82
R8011:Tiam2 UTSW 17 3448396 missense possibly damaging 0.92
X0027:Tiam2 UTSW 17 3414000 start codon destroyed probably null 1.00
X0060:Tiam2 UTSW 17 3450354 intron probably null
X0065:Tiam2 UTSW 17 3505708 missense probably damaging 1.00
Z1088:Tiam2 UTSW 17 3415019 missense probably benign 0.01
Z1176:Tiam2 UTSW 17 3505776 missense probably null 1.00
Z1177:Tiam2 UTSW 17 3427263 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCATCCCTGGGTTTGAG -3'
(R):5'- TTAACAAACCCTCTCTACTCGGAAG -3'

Sequencing Primer
(F):5'- CCATCTGTGTAGAGTCTGAAGAGCC -3'
(R):5'- TCTACTCGGAAGTATTTCTACAGC -3'
Posted On2019-05-15