Incidental Mutation 'PIT4431001:Cep162'
ID555252
Institutional Source Beutler Lab
Gene Symbol Cep162
Ensembl Gene ENSMUSG00000056919
Gene Namecentrosomal protein 162
Synonyms4922501C03Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #PIT4431001 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location87189577-87255536 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 87244345 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 171 (R171S)
Ref Sequence ENSEMBL: ENSMUSP00000091319 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093802]
Predicted Effect probably benign
Transcript: ENSMUST00000093802
AA Change: R171S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: R171S

DomainStartEndE-ValueType
low complexity region 198 208 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
coiled coil region 630 674 N/A INTRINSIC
coiled coil region 695 899 N/A INTRINSIC
coiled coil region 953 1124 N/A INTRINSIC
coiled coil region 1235 1386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Arhgap35 A T 7: 16,561,611 S1176R possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cope A G 8: 70,312,767 E289G probably damaging Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Olfr1248 T C 2: 89,617,857 I112V probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Thumpd3 T A 6: 113,059,978 N279K probably benign Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Unc13c C A 9: 73,749,547 C1124F probably damaging Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Cep162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00422:Cep162 APN 9 87227167 missense probably benign 0.24
IGL00584:Cep162 APN 9 87221090 splice site probably benign
IGL01387:Cep162 APN 9 87211811 missense probably benign 0.08
IGL01862:Cep162 APN 9 87253933 missense possibly damaging 0.90
IGL02304:Cep162 APN 9 87227147 splice site probably benign
IGL02558:Cep162 APN 9 87225733 missense probably benign 0.04
IGL02558:Cep162 APN 9 87225726 missense probably benign
IGL02602:Cep162 APN 9 87246153 missense probably benign 0.19
IGL02636:Cep162 APN 9 87248379 missense possibly damaging 0.90
IGL02680:Cep162 APN 9 87246744 missense possibly damaging 0.64
IGL03195:Cep162 APN 9 87225786 missense probably benign 0.00
circus UTSW 9 87206862 missense probably damaging 1.00
moscow UTSW 9 87193697 missense probably damaging 1.00
smiley UTSW 9 87217081 nonsense probably null
PIT4378001:Cep162 UTSW 9 87217145 missense probably benign 0.01
PIT4434001:Cep162 UTSW 9 87193648 missense probably damaging 1.00
R0060:Cep162 UTSW 9 87237825 splice site probably benign
R0218:Cep162 UTSW 9 87211809 missense possibly damaging 0.73
R0366:Cep162 UTSW 9 87220484 missense probably damaging 0.96
R0468:Cep162 UTSW 9 87193697 missense probably damaging 1.00
R0764:Cep162 UTSW 9 87201745 missense probably damaging 1.00
R1386:Cep162 UTSW 9 87221202 missense probably benign
R1614:Cep162 UTSW 9 87212932 missense probably damaging 1.00
R1633:Cep162 UTSW 9 87203683 missense probably benign 0.23
R1831:Cep162 UTSW 9 87206932 missense probably damaging 1.00
R1847:Cep162 UTSW 9 87204080 missense probably benign 0.06
R1941:Cep162 UTSW 9 87199995 missense probably benign 0.14
R2228:Cep162 UTSW 9 87244331 missense probably benign 0.05
R2256:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2257:Cep162 UTSW 9 87206914 missense probably damaging 1.00
R2936:Cep162 UTSW 9 87227414 missense probably benign
R3005:Cep162 UTSW 9 87232060 missense probably benign 0.00
R3508:Cep162 UTSW 9 87231977 critical splice donor site probably null
R3689:Cep162 UTSW 9 87225694 nonsense probably null
R3743:Cep162 UTSW 9 87217177 splice site probably benign
R4118:Cep162 UTSW 9 87204176 missense probably benign 0.30
R4380:Cep162 UTSW 9 87200003 missense probably damaging 0.99
R4450:Cep162 UTSW 9 87225808 missense probably damaging 1.00
R4540:Cep162 UTSW 9 87212939 missense probably damaging 1.00
R4598:Cep162 UTSW 9 87203795 missense possibly damaging 0.95
R4700:Cep162 UTSW 9 87206862 missense probably damaging 1.00
R4941:Cep162 UTSW 9 87225969 intron probably benign
R5356:Cep162 UTSW 9 87206895 missense probably damaging 1.00
R5468:Cep162 UTSW 9 87227237 missense probably benign 0.00
R5579:Cep162 UTSW 9 87203671 missense probably benign 0.26
R5859:Cep162 UTSW 9 87204092 missense probably damaging 1.00
R6114:Cep162 UTSW 9 87203710 missense probably benign
R6143:Cep162 UTSW 9 87212851 critical splice donor site probably null
R6422:Cep162 UTSW 9 87232016 missense possibly damaging 0.92
R6517:Cep162 UTSW 9 87222174 missense probably damaging 0.99
R6576:Cep162 UTSW 9 87217145 missense probably benign 0.01
R6782:Cep162 UTSW 9 87211684 missense probably benign 0.07
R6867:Cep162 UTSW 9 87217081 nonsense probably null
R7293:Cep162 UTSW 9 87203783 missense probably benign 0.01
R7355:Cep162 UTSW 9 87253955 nonsense probably null
R7391:Cep162 UTSW 9 87248494 nonsense probably null
R7426:Cep162 UTSW 9 87192766 missense probably damaging 1.00
R7593:Cep162 UTSW 9 87204197 missense probably benign 0.40
R7710:Cep162 UTSW 9 87232119 missense probably damaging 1.00
R7841:Cep162 UTSW 9 87244316 missense probably benign 0.00
R7949:Cep162 UTSW 9 87206848 missense probably benign 0.04
R8351:Cep162 UTSW 9 87192850 nonsense probably null
R8451:Cep162 UTSW 9 87192850 nonsense probably null
R8552:Cep162 UTSW 9 87244308 missense probably benign 0.34
R8755:Cep162 UTSW 9 87232011 missense probably benign 0.02
R8762:Cep162 UTSW 9 87227261 missense probably benign 0.00
X0063:Cep162 UTSW 9 87222042 critical splice donor site probably null
Z1177:Cep162 UTSW 9 87199980 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CTGCTTCTCGGAGAATCTCC -3'
(R):5'- GAGTTACCTGAGTCATGGGATGATAC -3'

Sequencing Primer
(F):5'- GAGAATCTCCCTGGACAACGTG -3'
(R):5'- CCTGAGTCATGGGATGATACATATAC -3'
Posted On2019-06-07