Mutagenetix > Incidental Mutations

Incidental Mutation 'R1614:Cep162'

177002

Institutional Source

Beutler Lab

Gene Symbol

Cep162

Ensembl Gene

ENSMUSG00000056919

Gene Name

centrosomal protein 162

Synonyms

4922501C03Rik

MMRRC Submission

039651-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.124) question?

Stock #

R1614 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

87189577-87255536 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 87212932 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 808 (D808G)

Ref Sequence

ENSEMBL: ENSMUSP00000091319 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000093802]

Predicted Effect

probably damaging
Transcript: ENSMUST00000093802
AA Change: D808G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000091319
Gene: ENSMUSG00000056919
AA Change: D808G

Domain	Start	End	E-Value	Type
low complexity region	198	208	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
coiled coil region	630	674	N/A	INTRINSIC
coiled coil region	695	899	N/A	INTRINSIC
coiled coil region	953	1124	N/A	INTRINSIC
coiled coil region	1235	1386	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139301

Meta Mutation Damage Score

0.1240

Coding Region Coverage

1x: 99.0%
3x: 98.1%
10x: 95.4%
20x: 89.4%

Validation Efficiency

100% (53/53)

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700125H20Rik	T	G	11: 85,172,864	S28A	possibly damaging	Het
Arl9	A	G	5: 77,010,565	T165A	probably benign	Het
Atpaf1	A	T	4: 115,796,757	K201N	possibly damaging	Het
Cacna1b	G	T	2: 24,690,807	Q676K	possibly damaging	Het
Ccdc88c	A	T	12: 100,912,984	H1959Q	probably benign	Het
Chtf18	A	G	17: 25,727,090	L42P	probably benign	Het
Cox7c	A	G	13: 86,045,785	F40L	probably benign	Het
Dock7	C	T	4: 99,061,280	V442I	probably benign	Het
Dst	T	C	1: 34,275,263	F4198S	probably damaging	Het
Fam13a	T	A	6: 58,940,184	D569V	probably damaging	Het
Gm6741	T	A	17: 91,236,996	H62Q	probably benign	Het
Gnptab	A	G	10: 88,414,589	T172A	probably benign	Het
Greb1	A	G	12: 16,701,171	S1013P	probably damaging	Het
Insl5	A	T	4: 103,026,649	L25*	probably null	Het
Ipo13	A	G	4: 117,904,618	S462P	probably benign	Het
Itgb1	G	A	8: 128,720,065	C401Y	probably damaging	Het
Kcnh7	G	T	2: 62,850,604	A213E	probably benign	Het
Kcnv1	G	A	15: 45,114,444	T66M	probably damaging	Het
Mesp2	T	C	7: 79,811,619	S231P	probably benign	Het
Nabp1	T	C	1: 51,471,352	N164D	possibly damaging	Het
Nop53	A	G	7: 15,945,965	V30A	probably benign	Het
Olfr1246	T	A	2: 89,590,696	I140L	possibly damaging	Het
Olfr1278	T	A	2: 111,293,066	V266E	probably damaging	Het
Olfr1318	T	A	2: 112,156,517	C189S	probably damaging	Het
Olfr346	T	G	2: 36,688,309	Y102*	probably null	Het
Pcsk5	G	A	19: 17,515,256	R918C	probably damaging	Het
Pecam1	T	C	11: 106,681,079	D554G	probably benign	Het
Polr2a	T	C	11: 69,743,373	I744V	possibly damaging	Het
Pop1	C	A	15: 34,530,210	A918D	possibly damaging	Het
Ppp2r5e	C	G	12: 75,469,567	A239P	probably damaging	Het
Prmt3	A	T	7: 49,826,719	I359F	possibly damaging	Het
Proz	G	A	8: 13,066,904	C152Y	probably damaging	Het
Ptgfr	A	C	3: 151,801,779	Y316D	probably benign	Het
Ralgapa2	G	T	2: 146,388,612	S1011Y	probably damaging	Het
Rnf43	C	T	11: 87,731,659	R529*	probably null	Het
Slc17a6	G	A	7: 51,646,277		probably benign	Het
Slc25a19	A	T	11: 115,616,623	C224*	probably null	Het
Smarcd3	A	G	5: 24,594,876	S299P	possibly damaging	Het
Stard9	T	C	2: 120,697,675	F1471S	possibly damaging	Het
Strada	A	C	11: 106,168,319	V211G	probably damaging	Het
Tom1l1	T	C	11: 90,683,254	E68G	probably damaging	Het
Vmn2r27	T	G	6: 124,223,934	I355L	probably benign	Het
Vmn2r68	A	T	7: 85,221,738	M779K	possibly damaging	Het
Zbtb18	T	C	1: 177,447,170	L23P	probably damaging	Het
Zfp112	G	T	7: 24,126,599	C664F	probably damaging	Het
Zfp955a	A	T	17: 33,242,332	N275K	possibly damaging	Het

Other mutations in Cep162

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00422:Cep162	APN	9	87227167	missense	probably benign	0.24
IGL00584:Cep162	APN	9	87221090	splice site	probably benign
IGL01387:Cep162	APN	9	87211811	missense	probably benign	0.08
IGL01862:Cep162	APN	9	87253933	missense	possibly damaging	0.90
IGL02304:Cep162	APN	9	87227147	splice site	probably benign
IGL02558:Cep162	APN	9	87225733	missense	probably benign	0.04
IGL02558:Cep162	APN	9	87225726	missense	probably benign
IGL02602:Cep162	APN	9	87246153	missense	probably benign	0.19
IGL02636:Cep162	APN	9	87248379	missense	possibly damaging	0.90
IGL02680:Cep162	APN	9	87246744	missense	possibly damaging	0.64
IGL03195:Cep162	APN	9	87225786	missense	probably benign	0.00
PIT4378001:Cep162	UTSW	9	87217145	missense	probably benign	0.01
PIT4431001:Cep162	UTSW	9	87244345	missense	probably benign	0.00
PIT4434001:Cep162	UTSW	9	87193648	missense	probably damaging	1.00
R0060:Cep162	UTSW	9	87237825	splice site	probably benign
R0218:Cep162	UTSW	9	87211809	missense	possibly damaging	0.73
R0366:Cep162	UTSW	9	87220484	missense	probably damaging	0.96
R0468:Cep162	UTSW	9	87193697	missense	probably damaging	1.00
R0764:Cep162	UTSW	9	87201745	missense	probably damaging	1.00
R1386:Cep162	UTSW	9	87221202	missense	probably benign
R1633:Cep162	UTSW	9	87203683	missense	probably benign	0.23
R1831:Cep162	UTSW	9	87206932	missense	probably damaging	1.00
R1847:Cep162	UTSW	9	87204080	missense	probably benign	0.06
R1941:Cep162	UTSW	9	87199995	missense	probably benign	0.14
R2228:Cep162	UTSW	9	87244331	missense	probably benign	0.05
R2256:Cep162	UTSW	9	87206914	missense	probably damaging	1.00
R2257:Cep162	UTSW	9	87206914	missense	probably damaging	1.00
R2936:Cep162	UTSW	9	87227414	missense	probably benign
R3005:Cep162	UTSW	9	87232060	missense	probably benign	0.00
R3508:Cep162	UTSW	9	87231977	critical splice donor site	probably null
R3689:Cep162	UTSW	9	87225694	nonsense	probably null
R3743:Cep162	UTSW	9	87217177	splice site	probably benign
R4118:Cep162	UTSW	9	87204176	missense	probably benign	0.30
R4380:Cep162	UTSW	9	87200003	missense	probably damaging	0.99
R4450:Cep162	UTSW	9	87225808	missense	probably damaging	1.00
R4540:Cep162	UTSW	9	87212939	missense	probably damaging	1.00
R4598:Cep162	UTSW	9	87203795	missense	possibly damaging	0.95
R4700:Cep162	UTSW	9	87206862	missense	probably damaging	1.00
R4941:Cep162	UTSW	9	87225969	intron	probably benign
R5356:Cep162	UTSW	9	87206895	missense	probably damaging	1.00
R5468:Cep162	UTSW	9	87227237	missense	probably benign	0.00
R5579:Cep162	UTSW	9	87203671	missense	probably benign	0.26
R5859:Cep162	UTSW	9	87204092	missense	probably damaging	1.00
R6114:Cep162	UTSW	9	87203710	missense	probably benign
R6143:Cep162	UTSW	9	87212851	critical splice donor site	probably null
R6422:Cep162	UTSW	9	87232016	missense	possibly damaging	0.92
R6517:Cep162	UTSW	9	87222174	missense	probably damaging	0.99
R6576:Cep162	UTSW	9	87217145	missense	probably benign	0.01
R6782:Cep162	UTSW	9	87211684	missense	probably benign	0.07
R6867:Cep162	UTSW	9	87217081	nonsense	probably null
R7293:Cep162	UTSW	9	87203783	missense	probably benign	0.01
R7355:Cep162	UTSW	9	87253955	nonsense	probably null
R7391:Cep162	UTSW	9	87248494	nonsense	probably null
R7426:Cep162	UTSW	9	87192766	missense	probably damaging	1.00
R7593:Cep162	UTSW	9	87204197	missense	probably benign	0.40
R7710:Cep162	UTSW	9	87232119	missense	probably damaging	1.00
R7841:Cep162	UTSW	9	87244316	missense	probably benign	0.00
R7949:Cep162	UTSW	9	87206848	missense	probably benign	0.04
R8351:Cep162	UTSW	9	87192850	nonsense	probably null
R8451:Cep162	UTSW	9	87192850	nonsense	probably null
R8552:Cep162	UTSW	9	87244308	missense	probably benign	0.34
X0063:Cep162	UTSW	9	87222042	critical splice donor site	probably null
Z1177:Cep162	UTSW	9	87199980	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GGCTACGACCACAGGCTTCTAAAC -3'
(R):5'- TGGGAAGACTGGACCCAACACTAC -3'

Sequencing Primer
(F):5'- ACTACAAGCTATGTTCAGGGTAAG -3'
(R):5'- CACTACAGGCTGTGGGAAGTTAC -3'

Posted On

2014-04-24