Incidental Mutation 'PIT4431001:Unc13c'
ID555250
Institutional Source Beutler Lab
Gene Symbol Unc13c
Ensembl Gene ENSMUSG00000062151
Gene Nameunc-13 homolog C (C. elegans)
SynonymsMunc13-3, Unc13h3, 1500037O19Rik, D9Ertd414e
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #PIT4431001 (G1)
Quality Score151.008
Status Not validated
Chromosome9
Chromosomal Location73479422-73968966 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73749547 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 1124 (C1124F)
Ref Sequence ENSEMBL: ENSMUSP00000074726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075245] [ENSMUST00000184666]
Predicted Effect probably damaging
Transcript: ENSMUST00000075245
AA Change: C1124F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074726
Gene: ENSMUSG00000062151
AA Change: C1124F

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1883 2023 2.6e-50 PFAM
C2 2058 2164 4.15e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000184666
AA Change: C1124F

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000139027
Gene: ENSMUSG00000062151
AA Change: C1124F

DomainStartEndE-ValueType
low complexity region 109 127 N/A INTRINSIC
low complexity region 153 164 N/A INTRINSIC
low complexity region 273 287 N/A INTRINSIC
low complexity region 464 491 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
C1 1094 1143 1.37e-17 SMART
C2 1217 1324 1.46e-22 SMART
DUF1041 1535 1642 3.18e-51 SMART
Blast:DUF1041 1714 1838 2e-49 BLAST
Pfam:Membr_traf_MHD 1882 2024 8.3e-59 PFAM
C2 2058 2164 4.15e-13 SMART
Coding Region Coverage
  • 1x: 93.2%
  • 3x: 90.7%
  • 10x: 84.7%
  • 20x: 71.4%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutant mice demonstrate an impaired ability to learn complex motor tasks, putatively due to an observed increase in paired-pulse facilitation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449I24Rik A G 5: 146,502,512 I29V probably benign Het
5730455P16Rik C A 11: 80,363,924 C357F probably damaging Het
Actr1a A T 19: 46,382,292 probably null Het
Adcy1 C G 11: 7,064,089 Q164E possibly damaging Het
Arhgap35 A T 7: 16,561,611 S1176R possibly damaging Het
Atad2b A G 12: 5,031,795 T1235A possibly damaging Het
Atp8a2 T C 14: 59,654,626 D1091G probably benign Het
Bmp6 T C 13: 38,485,930 S397P probably benign Het
C3 A T 17: 57,206,242 N1468K probably benign Het
Ccnjl CGCG CGCGGCG 11: 43,579,707 probably benign Het
Ccr1 T C 9: 123,964,194 I100V probably benign Het
Cep162 T A 9: 87,244,345 R171S probably benign Het
Chd8 T C 14: 52,218,249 H994R probably damaging Het
Cntn3 T A 6: 102,464,566 K6N probably benign Het
Cope A G 8: 70,312,767 E289G probably damaging Het
Cpne8 T G 15: 90,551,975 E279A probably damaging Het
Cyp11a1 A T 9: 58,016,272 probably null Het
Dcp2 A G 18: 44,412,571 K333R probably benign Het
Dpp6 G T 5: 27,631,498 V329F probably benign Het
Drc1 T A 5: 30,347,073 D186E probably damaging Het
Dsc2 G A 18: 20,046,277 Q245* probably null Het
Eef1e1 T C 13: 38,658,962 E11G probably damaging Het
Emilin2 G A 17: 71,255,995 P915S probably benign Het
Fam214b C A 4: 43,036,024 G236C probably damaging Het
Fpgt A G 3: 155,086,785 M535T possibly damaging Het
Fxyd3 G A 7: 31,071,355 L37F probably damaging Het
Gal3st2c T A 1: 94,008,112 I62N probably damaging Het
Gdpd3 T C 7: 126,766,475 I2T probably benign Het
Gm9611 T C 14: 42,293,931 M169V Het
Ints3 G A 3: 90,396,460 T720I probably damaging Het
Itpr2 T G 6: 146,354,720 M992L probably benign Het
L3mbtl2 T A 15: 81,676,307 H256Q probably benign Het
Lama2 T C 10: 27,101,430 T1918A probably damaging Het
Lpcat2b G A 5: 107,434,131 G442D probably damaging Het
Lrp1b C T 2: 41,004,755 V2268M Het
Macc1 T C 12: 119,446,511 L338P probably benign Het
Mtmr2 T C 9: 13,793,179 F201L probably benign Het
Mtr C T 13: 12,212,443 V772M probably damaging Het
Mtus2 A G 5: 148,076,705 T103A probably benign Het
Myo5c A G 9: 75,252,571 I294V possibly damaging Het
Ncam1 A T 9: 49,798,693 F13I probably benign Het
Olfr1248 T C 2: 89,617,857 I112V probably benign Het
Paqr6 A T 3: 88,365,777 I52F possibly damaging Het
Pde2a T G 7: 101,501,897 V271G probably damaging Het
Pde7b T C 10: 20,400,545 H405R possibly damaging Het
Plxnb1 A G 9: 109,100,718 Y214C probably damaging Het
Pmp22 T C 11: 63,151,241 F101L probably benign Het
Pold1 A G 7: 44,538,894 L520P probably damaging Het
Pramel1 A G 4: 143,398,390 T295A possibly damaging Het
Psg20 A T 7: 18,674,550 I415N probably damaging Het
Ptcd2 T A 13: 99,340,019 R71* probably null Het
Ptgs1 A T 2: 36,240,680 N197I probably damaging Het
Rbfox3 T C 11: 118,495,221 D333G probably damaging Het
Rfx7 T A 9: 72,617,971 H814Q probably benign Het
Rptn TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG TGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCAGGGTCAGAAAGGCAGACAAGACCTGAGTTCTCACCAGGGTCAGAAAGGCAGACAAGACCAGAGTCCTCACCTGGGTCAGAAAGGCAGGCATGACCAGAGTCCTCACCGGGGTCAGAAAGGCAGGCAAGACCAGAGTCCTCACCAGGGTCAGAAAGGCAG 3: 93,397,397 probably benign Het
Serpina3i A T 12: 104,265,173 H23L probably benign Het
Sipa1l1 T A 12: 82,396,516 V860E probably benign Het
Slc12a1 T A 2: 125,190,204 Y592N possibly damaging Het
Slco2a1 T C 9: 103,050,268 F120S probably damaging Het
Smyd4 T C 11: 75,403,513 F740S probably damaging Het
Sppl2a T C 2: 126,923,476 Y242C probably damaging Het
Sqle A G 15: 59,323,660 K288R probably benign Het
Tbc1d17 A G 7: 44,845,074 S246P probably benign Het
Tenm3 G A 8: 48,235,607 T2315M probably damaging Het
Tgfb1i1 C T 7: 128,249,181 R191C probably damaging Het
Thumpd3 T A 6: 113,059,978 N279K probably benign Het
Tmed5 T A 5: 108,130,021 H95L possibly damaging Het
Tmem161a T C 8: 70,182,024 L443P probably damaging Het
Ttc38 C A 15: 85,836,127 Q97K probably benign Het
Vmn2r102 A G 17: 19,676,696 T102A possibly damaging Het
Vwce G A 19: 10,664,582 E891K possibly damaging Het
Xkr5 A T 8: 18,934,345 S394T possibly damaging Het
Zan C T 5: 137,392,064 C4747Y unknown Het
Zfp804a T C 2: 82,259,192 F1122L probably benign Het
Other mutations in Unc13c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Unc13c APN 9 73736703 missense probably damaging 0.99
IGL00693:Unc13c APN 9 73758602 missense probably benign 0.18
IGL01022:Unc13c APN 9 73517328 missense probably benign 0.06
IGL01088:Unc13c APN 9 73932281 missense possibly damaging 0.63
IGL01123:Unc13c APN 9 73933197 missense probably benign 0.05
IGL01131:Unc13c APN 9 73564053 missense probably benign
IGL01135:Unc13c APN 9 73484893 missense probably damaging 1.00
IGL01393:Unc13c APN 9 73540270 missense probably benign 0.06
IGL01752:Unc13c APN 9 73931811 missense probably benign 0.01
IGL01893:Unc13c APN 9 73693366 missense probably benign 0.15
IGL01897:Unc13c APN 9 73546027 missense probably damaging 0.99
IGL01936:Unc13c APN 9 73693242 missense probably benign 0.07
IGL02122:Unc13c APN 9 73734397 splice site probably benign
IGL02341:Unc13c APN 9 73933210 missense possibly damaging 0.76
IGL02434:Unc13c APN 9 73932628 missense probably benign 0.01
IGL02545:Unc13c APN 9 73481075 missense probably damaging 0.98
IGL02709:Unc13c APN 9 73558956 missense probably benign 0.00
IGL02815:Unc13c APN 9 73540263 missense possibly damaging 0.83
IGL02904:Unc13c APN 9 73481067 nonsense probably null
IGL03117:Unc13c APN 9 73534025 missense probably benign 0.03
IGL03260:Unc13c APN 9 73931344 missense probably benign 0.11
PIT4651001:Unc13c UTSW 9 73483739 missense possibly damaging 0.48
R0017:Unc13c UTSW 9 73693301 missense probably benign 0.07
R0039:Unc13c UTSW 9 73669565 splice site probably benign
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0164:Unc13c UTSW 9 73694892 missense probably benign 0.01
R0308:Unc13c UTSW 9 73481118 missense probably benign 0.04
R0344:Unc13c UTSW 9 73930785 missense probably benign 0.39
R0421:Unc13c UTSW 9 73933210 missense possibly damaging 0.76
R0606:Unc13c UTSW 9 73530983 splice site probably benign
R0655:Unc13c UTSW 9 73930953 missense probably damaging 0.96
R1013:Unc13c UTSW 9 73933332 missense probably benign 0.45
R1293:Unc13c UTSW 9 73574074 missense probably benign 0.06
R1493:Unc13c UTSW 9 73639068 missense probably benign 0.27
R1675:Unc13c UTSW 9 73639050 critical splice donor site probably null
R1789:Unc13c UTSW 9 73756339 missense possibly damaging 0.92
R2001:Unc13c UTSW 9 73483615 splice site probably null
R2055:Unc13c UTSW 9 73736550 missense probably damaging 1.00
R2060:Unc13c UTSW 9 73665656 missense probably damaging 0.99
R2420:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2421:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R2422:Unc13c UTSW 9 73931547 missense probably damaging 0.97
R3415:Unc13c UTSW 9 73932586 missense probably benign 0.00
R3423:Unc13c UTSW 9 73930653 missense possibly damaging 0.46
R3820:Unc13c UTSW 9 73930958 missense probably benign 0.00
R3857:Unc13c UTSW 9 73699108 nonsense probably null
R3859:Unc13c UTSW 9 73699108 nonsense probably null
R3895:Unc13c UTSW 9 73933523 missense probably benign
R4038:Unc13c UTSW 9 73533906 critical splice donor site probably null
R4077:Unc13c UTSW 9 73736539 nonsense probably null
R4125:Unc13c UTSW 9 73574007 critical splice donor site probably null
R4128:Unc13c UTSW 9 73734537 missense probably damaging 1.00
R4235:Unc13c UTSW 9 73530952 missense possibly damaging 0.68
R4295:Unc13c UTSW 9 73734504 missense probably damaging 1.00
R4307:Unc13c UTSW 9 73693367 missense probably benign 0.06
R4658:Unc13c UTSW 9 73932826 missense probably damaging 1.00
R4694:Unc13c UTSW 9 73572354 missense probably benign 0.00
R4735:Unc13c UTSW 9 73693338 missense probably benign 0.00
R4744:Unc13c UTSW 9 73931844 missense probably damaging 1.00
R4795:Unc13c UTSW 9 73932187 missense probably damaging 0.97
R4827:Unc13c UTSW 9 73931286 missense probably damaging 1.00
R4838:Unc13c UTSW 9 73932072 missense possibly damaging 0.68
R4869:Unc13c UTSW 9 73680434 missense probably benign 0.02
R4873:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4875:Unc13c UTSW 9 73517284 missense probably damaging 0.98
R4876:Unc13c UTSW 9 73749539 missense probably damaging 1.00
R4905:Unc13c UTSW 9 73680392 missense probably benign
R4912:Unc13c UTSW 9 73574022 missense probably damaging 0.99
R5026:Unc13c UTSW 9 73930903 missense possibly damaging 0.74
R5127:Unc13c UTSW 9 73933372 missense probably benign 0.26
R5151:Unc13c UTSW 9 73931475 missense probably benign 0.02
R5171:Unc13c UTSW 9 73757954 missense probably benign
R5244:Unc13c UTSW 9 73525951 critical splice donor site probably null
R5342:Unc13c UTSW 9 73930823 missense probably benign 0.00
R5399:Unc13c UTSW 9 73749688 missense possibly damaging 0.95
R5409:Unc13c UTSW 9 73578390 missense possibly damaging 0.78
R5460:Unc13c UTSW 9 73545989 missense probably benign
R5680:Unc13c UTSW 9 73932602 missense probably damaging 1.00
R5681:Unc13c UTSW 9 73546075 splice site probably null
R5728:Unc13c UTSW 9 73558956 missense probably benign 0.01
R5762:Unc13c UTSW 9 73812367 missense probably benign 0.00
R5764:Unc13c UTSW 9 73533903 splice site probably null
R5829:Unc13c UTSW 9 73693368 missense probably benign 0.15
R5894:Unc13c UTSW 9 73693204 critical splice donor site probably null
R5936:Unc13c UTSW 9 73578492 missense probably damaging 1.00
R6043:Unc13c UTSW 9 73736651 missense possibly damaging 0.88
R6046:Unc13c UTSW 9 73930884 missense probably benign
R6148:Unc13c UTSW 9 73693366 missense probably benign 0.15
R6207:Unc13c UTSW 9 73758628 missense possibly damaging 0.89
R6277:Unc13c UTSW 9 73699169 missense probably damaging 1.00
R6338:Unc13c UTSW 9 73734447 missense probably damaging 0.99
R6615:Unc13c UTSW 9 73930608 missense possibly damaging 0.63
R6978:Unc13c UTSW 9 73931977 missense probably benign 0.39
R7053:Unc13c UTSW 9 73932297 missense probably damaging 1.00
R7223:Unc13c UTSW 9 73629191 missense probably benign 0.44
R7259:Unc13c UTSW 9 73517363 missense probably benign 0.00
R7353:Unc13c UTSW 9 73574073 missense probably benign 0.00
R7357:Unc13c UTSW 9 73933528 small insertion probably benign
R7357:Unc13c UTSW 9 73933529 small insertion probably benign
R7607:Unc13c UTSW 9 73669535 missense probably damaging 0.98
R7626:Unc13c UTSW 9 73734517 missense probably damaging 1.00
R7639:Unc13c UTSW 9 73933168 missense probably damaging 0.99
R7657:Unc13c UTSW 9 73533903 splice site probably null
R7665:Unc13c UTSW 9 73680474 missense probably benign 0.28
R7704:Unc13c UTSW 9 73699212 missense probably benign 0.27
R7776:Unc13c UTSW 9 73694950 missense probably damaging 1.00
R7811:Unc13c UTSW 9 73693271 missense possibly damaging 0.46
R7833:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7839:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7869:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R7916:Unc13c UTSW 9 73481109 missense possibly damaging 0.53
R7922:Unc13c UTSW 9 73933314 missense possibly damaging 0.63
R7952:Unc13c UTSW 9 73694877 missense probably damaging 1.00
R8047:Unc13c UTSW 9 73812354 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCAAGTCCATGACTGGTCG -3'
(R):5'- AGCCACTGATTTGCTTTGCC -3'

Sequencing Primer
(F):5'- ATGACTGGTCGGCCATCAGTG -3'
(R):5'- CTTGTTCCCGCTCTTAAACTCACAG -3'
Posted On2019-06-07