Mutagenetix > Incidental Mutation

Incidental Mutation 'R7395:Cubn'

573704

Institutional Source

Beutler Lab

Gene Symbol

Cubn

Ensembl Gene

ENSMUSG00000026726

Gene Name

cubilin (intrinsic factor-cobalamin receptor)

Synonyms

D2Wsu88e

MMRRC Submission

Accession Numbers

Genbank: NM_001081084; MGI: 1931256

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7395 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

13276338-13491813 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 13287064 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Lysine at position 3317 (Q3317K)

Ref Sequence

ENSEMBL: ENSMUSP00000089009 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091436]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000091436
AA Change: Q3317K

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000089009
Gene: ENSMUSG00000026726
AA Change: Q3317K

Domain	Start	End	E-Value	Type
signal peptide	1	20	N/A	INTRINSIC
EGF	132	165	2.14e-5	SMART
EGF_CA	167	208	1.95e-8	SMART
EGF	213	258	2.85e-1	SMART
EGF_CA	260	301	2.66e-10	SMART
EGF_CA	302	345	7.07e-6	SMART
EGF	349	393	1.01e-1	SMART
EGF	398	430	3.73e-5	SMART
EGF_CA	432	468	8.63e-10	SMART
CUB	474	586	4.4e-21	SMART
CUB	590	702	3.82e-39	SMART
CUB	708	816	3.66e-18	SMART
CUB	817	928	3.09e-25	SMART
CUB	932	1042	1.29e-36	SMART
CUB	1048	1161	3.46e-37	SMART
CUB	1165	1277	7.24e-40	SMART
CUB	1278	1389	8.33e-31	SMART
CUB	1391	1506	3.08e-43	SMART
CUB	1510	1619	1.9e-34	SMART
CUB	1620	1734	7.24e-40	SMART
CUB	1738	1850	6.02e-37	SMART
CUB	1852	1963	1.57e-26	SMART
CUB	1978	2091	3.46e-28	SMART
CUB	2092	2213	2.88e-34	SMART
CUB	2217	2334	4.13e-35	SMART
CUB	2336	2448	3.1e-39	SMART
CUB	2452	2565	5.37e-34	SMART
CUB	2570	2687	3e-23	SMART
CUB	2689	2801	3.1e-39	SMART
CUB	2805	2919	2.36e-21	SMART
CUB	2920	3035	6.18e-25	SMART
CUB	3037	3150	5.16e-36	SMART
CUB	3157	3274	1.68e-35	SMART
CUB	3278	3393	7.17e-12	SMART
CUB	3395	3507	2.49e-29	SMART
CUB	3511	3623	2.4e-22	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

99% (92/93)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Cubilin (CUBN) acts as a receptor for intrinsic factor-vitamin B12 complexes. The role of receptor is supported by the presence of 27 CUB domains. Cubulin is located within the epithelium of intestine and kidney. Mutations in CUBN may play a role in autosomal recessive megaloblastic anemia. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, yolk sac and allantoic vasculature defects, embryonic and visceral endoderm defects, and lack somites. Heterozygotes display incomplete penetrance of premature death. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, other(1) Gene trapped(3)

Other mutations in this stock

Total: 94 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3830403N18Rik	G	T	X: 56,138,780		probably null	Het
4930433I11Rik	A	T	7: 40,989,678	T13S	probably damaging	Het
Abca13	A	G	11: 9,291,658	I1174V	probably benign	Het
Acoxl	G	A	2: 127,884,416	V237M	probably damaging	Het
Adam33	A	C	2: 131,061,169	W52G	probably benign	Het
Adgrv1	T	C	13: 81,559,348	H1313R	probably damaging	Het
Ap3d1	T	C	10: 80,730,882	T89A	probably benign	Het
Armc8	T	C	9: 99,533,132	E165G	probably damaging	Het
Atp6v1c1	T	C	15: 38,691,705	*383Q	probably null	Het
Atp8b4	A	T	2: 126,375,694	L634Q	possibly damaging	Het
B3glct	A	G	5: 149,725,604		probably null	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
Bicd2	A	G	13: 49,378,230	D316G	possibly damaging	Het
Bop1	A	T	15: 76,453,841	S610T	probably damaging	Het
Car11	T	A	7: 45,701,321	Y80*	probably null	Het
Ccdc96	T	C	5: 36,485,265	I205T	probably benign	Het
Ces2a	A	G	8: 104,739,641	E390G	probably benign	Het
Cfap54	C	A	10: 92,884,703	V2630L	unknown	Het
Chek2	G	T	5: 110,872,108		probably null	Het
Cntn3	C	T	6: 102,337,394		probably null	Het
Cpne3	A	T	4: 19,528,239	D339E	probably damaging	Het
Crocc2	C	T	1: 93,216,107	Q1403*	probably null	Het
Csnka2ip	G	A	16: 64,479,440	T187I		Het
Ctu1	A	G	7: 43,676,595	H226R	possibly damaging	Het
Cyp17a1	A	G	19: 46,670,695	L169P	probably benign	Het
Dcc	T	A	18: 71,374,569	K911*	probably null	Het
Dcun1d2	G	A	8: 13,278,675	R75*	probably null	Het
Defb19	A	T	2: 152,580,023		probably null	Het
Dffb	A	T	4: 153,969,113	S257R	probably damaging	Het
Dip2c	A	C	13: 9,614,377	N942T	probably damaging	Het
Dnah3	T	A	7: 119,966,251	I169F		Het
Dnah3	T	C	7: 120,060,960	M830V	probably benign	Het
Dnajc5g	G	A	5: 31,111,665	S130N	possibly damaging	Het
Dscaml1	C	A	9: 45,702,405	Q939K	possibly damaging	Het
Evpl	G	C	11: 116,227,079	N761K	possibly damaging	Het
Fbxw8	A	T	5: 118,068,215	I556N	probably damaging	Het
Fry	G	T	5: 150,380,883	M579I	possibly damaging	Het
Ggt7	A	T	2: 155,495,880	M488K	probably benign	Het
Gm6588	A	T	5: 112,450,169	E194V	possibly damaging	Het
Gnpnat1	T	A	14: 45,381,581	H107L	probably benign	Het
Golga2	C	A	2: 32,305,587	P798Q	possibly damaging	Het
Gpr35	G	A	1: 92,983,207	A214T	probably damaging	Het
Greb1	A	T	12: 16,709,430		probably null	Het
Hdac10	G	A	15: 89,128,284	T32I	probably benign	Het
Hkdc1	G	A	10: 62,385,699	T860I	probably damaging	Het
Icam5	C	A	9: 21,035,442	P422Q	possibly damaging	Het
Ispd	A	T	12: 36,501,995	I283F	possibly damaging	Het
Ist1	A	C	8: 109,677,527	S238A	probably benign	Het
Lrig2	T	C	3: 104,497,520	N91D	probably benign	Het
Mapt	A	C	11: 104,328,123	D352A	probably damaging	Het
Micall2	G	A	5: 139,716,369	P373L	possibly damaging	Het
Mocs1	A	G	17: 49,454,557	S560G	possibly damaging	Het
Mpo	A	G	11: 87,801,124	D461G	probably damaging	Het
Myo1a	G	T	10: 127,710,440	V271L	probably damaging	Het
Ncoa1	G	A	12: 4,295,188	P720S	not run	Het
Ncr1	T	A	7: 4,338,151	I47N	probably damaging	Het
Ndufb6	G	A	4: 40,277,730	R66C	probably damaging	Het
Obox5	A	T	7: 15,758,743	S208C	probably damaging	Het
Olfr136	A	T	17: 38,335,864	K236*	probably null	Het
Olfr1494	T	C	19: 13,749,138	S11P	probably damaging	Het
Olfr39	T	A	9: 20,286,530	M285K	probably damaging	Het
Olfr501-ps1	T	A	7: 108,508,404	F116Y	unknown	Het
Padi4	A	C	4: 140,761,672	V152G	probably damaging	Het
Pdzd7	A	T	19: 45,037,011	D348E	probably damaging	Het
Pdzph1	T	A	17: 58,879,159	K1212N	possibly damaging	Het
Piezo2	C	T	18: 63,027,563	G2341R	probably damaging	Het
Plb1	A	G	5: 32,353,684	K1298E	probably benign	Het
Prr14l	A	G	5: 32,828,638	L1171P	probably benign	Het
Rab11fip5	T	C	6: 85,341,868	T680A	probably benign	Het
Rev1	A	T	1: 38,088,065	N371K	possibly damaging	Het
Rsf1	CGGCGGCGG	CGGCGGCGGGGGCGGCGG	7: 97,579,926		probably benign	Het
Ryr2	A	G	13: 11,785,111	C917R	probably damaging	Het
Sall1	A	T	8: 89,030,921	S852T	possibly damaging	Het
Serpine2	A	G	1: 79,801,555	F296L	probably damaging	Het
Slc12a6	A	T	2: 112,352,542	N754I	probably damaging	Het
Slc39a6	A	T	18: 24,585,275	L575Q	probably damaging	Het
Smarcc2	T	A	10: 128,485,606	L890Q	probably damaging	Het
Smg5	T	A	3: 88,361,071	V1006D	probably damaging	Het
Ssh2	T	C	11: 77,393,073	V51A	probably damaging	Het
St14	T	C	9: 31,096,899	K547E	probably benign	Het
Stag1	T	G	9: 100,796,728	V234G	probably damaging	Het
Stag3	A	T	5: 138,281,945	Q24L	probably benign	Het
Stra6	T	C	9: 58,141,097	Y158H	probably damaging	Het
Tcstv1	A	T	13: 119,894,130		probably null	Het
Tmem196	G	A	12: 120,011,267	C62Y	probably damaging	Het
Tmem265	T	A	7: 127,564,867	F84L		Het
Tph1	C	T	7: 46,657,203		probably null	Het
Ttn	A	G	2: 76,946,490	I1522T	unknown	Het
Ulk4	T	A	9: 121,255,112	Q129L	probably benign	Het
Usp17la	T	A	7: 104,861,585	S466T	probably benign	Het
Vmn2r31	A	T	7: 7,384,745	V609E	probably damaging	Het
Vmn2r52	C	T	7: 10,170,817	C365Y	probably benign	Het
Zbtb4	A	T	11: 69,776,111	T81S	possibly damaging	Het
Zfp605	A	T	5: 110,112,019		probably benign	Het

Other mutations in Cubn

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Cubn	APN	2	13491820	unclassified	probably benign
IGL00228:Cubn	APN	2	13456697	missense	probably damaging	1.00
IGL00231:Cubn	APN	2	13381849	missense	possibly damaging	0.89
IGL00327:Cubn	APN	2	13427056	missense	possibly damaging	0.73
IGL00470:Cubn	APN	2	13278418	missense	probably benign	0.00
IGL00519:Cubn	APN	2	13282919	missense	probably benign	0.00
IGL00562:Cubn	APN	2	13294230	missense	probably benign	0.01
IGL00678:Cubn	APN	2	13467710	missense	possibly damaging	0.47
IGL00834:Cubn	APN	2	13381927	missense	probably damaging	1.00
IGL00946:Cubn	APN	2	13456623	missense	probably damaging	0.98
IGL00971:Cubn	APN	2	13278408	missense	possibly damaging	0.77
IGL01124:Cubn	APN	2	13478093	missense	possibly damaging	0.62
IGL01287:Cubn	APN	2	13310566	missense	probably damaging	1.00
IGL01410:Cubn	APN	2	13465908	missense	probably benign	0.31
IGL01418:Cubn	APN	2	13284041	missense	probably benign	0.01
IGL01450:Cubn	APN	2	13350862	splice site	probably benign
IGL01534:Cubn	APN	2	13465933	nonsense	probably null
IGL01584:Cubn	APN	2	13308661	splice site	probably benign
IGL01595:Cubn	APN	2	13325216	missense	probably benign	0.05
IGL01625:Cubn	APN	2	13306274	missense	possibly damaging	0.76
IGL01732:Cubn	APN	2	13489936	nonsense	probably null
IGL01972:Cubn	APN	2	13446072	missense	possibly damaging	0.90
IGL02027:Cubn	APN	2	13287594	missense	probably damaging	1.00
IGL02033:Cubn	APN	2	13339846	missense	probably damaging	0.98
IGL02124:Cubn	APN	2	13381837	missense	probably damaging	0.99
IGL02335:Cubn	APN	2	13427834	splice site	probably null
IGL02491:Cubn	APN	2	13321228	missense	probably damaging	1.00
IGL02686:Cubn	APN	2	13325226	missense	possibly damaging	0.92
IGL02707:Cubn	APN	2	13446032	missense	probably damaging	0.99
IGL02746:Cubn	APN	2	13445040	missense	probably damaging	1.00
IGL02873:Cubn	APN	2	13294370	missense	probably benign	0.07
IGL02897:Cubn	APN	2	13318312	missense	possibly damaging	0.55
IGL03078:Cubn	APN	2	13287094	missense	possibly damaging	0.87
IGL03245:Cubn	APN	2	13355689	missense	probably benign	0.09
IGL03289:Cubn	APN	2	13426967	missense	probably benign	0.00
IGL03335:Cubn	APN	2	13360329	missense	probably damaging	1.00
IGL03355:Cubn	APN	2	13478057	splice site	probably null
mellow	UTSW	2	13478078	missense	probably damaging	1.00
PIT4354001:Cubn	UTSW	2	13468852	nonsense	probably null
PIT4495001:Cubn	UTSW	2	13491750	missense	probably benign	0.00
R0145:Cubn	UTSW	2	13306432	missense	probably damaging	1.00
R0220:Cubn	UTSW	2	13356709	missense	probably damaging	1.00
R0254:Cubn	UTSW	2	13424694	missense	probably benign	0.01
R0254:Cubn	UTSW	2	13440514	missense	possibly damaging	0.84
R0254:Cubn	UTSW	2	13476035	critical splice donor site	probably null
R0360:Cubn	UTSW	2	13310507	splice site	probably benign
R0364:Cubn	UTSW	2	13310507	splice site	probably benign
R0383:Cubn	UTSW	2	13430959	missense	probably damaging	1.00
R0419:Cubn	UTSW	2	13469763	missense	possibly damaging	0.77
R0419:Cubn	UTSW	2	13469764	missense	possibly damaging	0.87
R0498:Cubn	UTSW	2	13444267	missense	probably damaging	0.99
R0560:Cubn	UTSW	2	13428680	missense	probably damaging	1.00
R0615:Cubn	UTSW	2	13360252	splice site	probably null
R0735:Cubn	UTSW	2	13491689	splice site	probably benign
R0780:Cubn	UTSW	2	13456613	missense	probably damaging	1.00
R0899:Cubn	UTSW	2	13362328	missense	possibly damaging	0.54
R1118:Cubn	UTSW	2	13336242	missense	possibly damaging	0.78
R1182:Cubn	UTSW	2	13445000	missense	probably damaging	0.98
R1439:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R1450:Cubn	UTSW	2	13360319	missense	probably damaging	1.00
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1464:Cubn	UTSW	2	13325288	missense	possibly damaging	0.87
R1476:Cubn	UTSW	2	13476120	missense	probably benign	0.04
R1508:Cubn	UTSW	2	13427105	missense	probably benign	0.25
R1532:Cubn	UTSW	2	13287661	missense	probably damaging	1.00
R1562:Cubn	UTSW	2	13427967	missense	probably damaging	1.00
R1598:Cubn	UTSW	2	13469789	missense	probably benign	0.00
R1761:Cubn	UTSW	2	13489317	critical splice donor site	probably null
R1862:Cubn	UTSW	2	13308561	missense	probably damaging	1.00
R1874:Cubn	UTSW	2	13323002	missense	probably damaging	1.00
R1923:Cubn	UTSW	2	13310526	missense	probably damaging	1.00
R1944:Cubn	UTSW	2	13278538	missense	probably benign	0.01
R1960:Cubn	UTSW	2	13340017	splice site	probably null
R2021:Cubn	UTSW	2	13308549	missense	probably benign	0.09
R2137:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2138:Cubn	UTSW	2	13444378	missense	probably damaging	0.99
R2139:Cubn	UTSW	2	13336167	missense	probably benign	0.01
R2179:Cubn	UTSW	2	13318242	missense	possibly damaging	0.85
R2328:Cubn	UTSW	2	13404080	nonsense	probably null
R2369:Cubn	UTSW	2	13491217	missense	probably damaging	1.00
R2428:Cubn	UTSW	2	13476150	missense	probably damaging	1.00
R2435:Cubn	UTSW	2	13318272	missense	probably damaging	1.00
R2567:Cubn	UTSW	2	13278356	splice site	probably null
R2850:Cubn	UTSW	2	13322953	missense	probably damaging	1.00
R2853:Cubn	UTSW	2	13430834	missense	probably benign	0.00
R2893:Cubn	UTSW	2	13358139	missense	possibly damaging	0.61
R3107:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3109:Cubn	UTSW	2	13362347	missense	possibly damaging	0.73
R3119:Cubn	UTSW	2	13358162	missense	possibly damaging	0.90
R3405:Cubn	UTSW	2	13333508	missense	probably benign	0.00
R3703:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3704:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3705:Cubn	UTSW	2	13350943	missense	probably damaging	1.00
R3764:Cubn	UTSW	2	13331585	missense	possibly damaging	0.79
R3792:Cubn	UTSW	2	13427914	missense	probably damaging	1.00
R3802:Cubn	UTSW	2	13360353	missense	probably benign	0.01
R3813:Cubn	UTSW	2	13294325	missense	probably damaging	1.00
R3845:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3846:Cubn	UTSW	2	13283008	missense	probably damaging	1.00
R3900:Cubn	UTSW	2	13286980	critical splice donor site	probably null
R3921:Cubn	UTSW	2	13326677	missense	probably damaging	1.00
R4075:Cubn	UTSW	2	13313999	missense	possibly damaging	0.58
R4082:Cubn	UTSW	2	13428563	intron	probably benign
R4405:Cubn	UTSW	2	13466030	missense	probably damaging	1.00
R4615:Cubn	UTSW	2	13428749	missense	probably damaging	1.00
R4629:Cubn	UTSW	2	13313979	splice site	probably null
R4770:Cubn	UTSW	2	13314767	missense	possibly damaging	0.92
R4799:Cubn	UTSW	2	13287024	missense	possibly damaging	0.94
R4799:Cubn	UTSW	2	13351058	missense	probably damaging	1.00
R4812:Cubn	UTSW	2	13459076	missense	probably damaging	1.00
R4825:Cubn	UTSW	2	13325225	missense	probably damaging	1.00
R4934:Cubn	UTSW	2	13489910	missense	probably benign	0.06
R4967:Cubn	UTSW	2	13348045	missense	probably benign	0.01
R5187:Cubn	UTSW	2	13287568	missense	probably damaging	0.96
R5232:Cubn	UTSW	2	13478202	nonsense	probably null
R5305:Cubn	UTSW	2	13388939	missense	probably damaging	1.00
R5506:Cubn	UTSW	2	13491695	splice site	probably null
R5530:Cubn	UTSW	2	13308523	missense	probably damaging	1.00
R5531:Cubn	UTSW	2	13350932	missense	probably benign	0.00
R5737:Cubn	UTSW	2	13388891	missense	probably damaging	1.00
R5886:Cubn	UTSW	2	13320023	splice site	probably benign
R5923:Cubn	UTSW	2	13486078	missense	possibly damaging	0.73
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6032:Cubn	UTSW	2	13325184	missense	probably benign	0.12
R6084:Cubn	UTSW	2	13430897	missense	probably damaging	1.00
R6087:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R6133:Cubn	UTSW	2	13308618	missense	probably benign	0.29
R6181:Cubn	UTSW	2	13349876	missense	probably benign	0.31
R6301:Cubn	UTSW	2	13478078	missense	probably damaging	1.00
R6320:Cubn	UTSW	2	13280195	missense	probably damaging	1.00
R6368:Cubn	UTSW	2	13430995	missense	probably damaging	0.96
R6368:Cubn	UTSW	2	13476123	missense	probably damaging	0.98
R6383:Cubn	UTSW	2	13427835	critical splice donor site	probably null
R6393:Cubn	UTSW	2	13355680	missense	probably benign	0.08
R6408:Cubn	UTSW	2	13294203	missense	probably damaging	1.00
R6470:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R6532:Cubn	UTSW	2	13459002	missense	probably benign	0.01
R6599:Cubn	UTSW	2	13310673	missense	possibly damaging	0.95
R6629:Cubn	UTSW	2	13430872	missense	probably damaging	1.00
R6641:Cubn	UTSW	2	13476064	missense	probably damaging	1.00
R6800:Cubn	UTSW	2	13321255	missense	probably damaging	1.00
R6823:Cubn	UTSW	2	13445029	missense	probably benign	0.21
R6847:Cubn	UTSW	2	13444253	critical splice donor site	probably null
R6885:Cubn	UTSW	2	13318278	missense	probably damaging	1.00
R6962:Cubn	UTSW	2	13348029	missense	probably benign	0.03
R6973:Cubn	UTSW	2	13381837	missense	possibly damaging	0.61
R6975:Cubn	UTSW	2	13486789	missense	probably damaging	0.99
R7076:Cubn	UTSW	2	13306280	missense	probably benign	0.00
R7076:Cubn	UTSW	2	13306281	missense	probably benign	0.10
R7086:Cubn	UTSW	2	13319858	missense	probably damaging	0.98
R7162:Cubn	UTSW	2	13342498	missense	probably damaging	0.96
R7203:Cubn	UTSW	2	13351003	missense	probably benign	0.01
R7292:Cubn	UTSW	2	13424739	missense	probably damaging	0.99
R7307:Cubn	UTSW	2	13340332	missense	probably damaging	0.99
R7329:Cubn	UTSW	2	13468771	missense	probably damaging	0.99
R7417:Cubn	UTSW	2	13426967	missense	probably benign	0.00
R7429:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7430:Cubn	UTSW	2	13322993	missense	possibly damaging	0.87
R7443:Cubn	UTSW	2	13455509	missense	probably damaging	1.00
R7699:Cubn	UTSW	2	13348178	missense	probably benign
R7699:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7700:Cubn	UTSW	2	13348178	missense	probably benign
R7700:Cubn	UTSW	2	13489917	missense	possibly damaging	0.74
R7751:Cubn	UTSW	2	13360365	missense	probably damaging	1.00
R7755:Cubn	UTSW	2	13280078	missense	probably benign	0.11
R7759:Cubn	UTSW	2	13348150	missense	probably damaging	1.00
R7903:Cubn	UTSW	2	13468869	missense	probably damaging	0.97
R7921:Cubn	UTSW	2	13424727	missense	probably benign	0.22
R7988:Cubn	UTSW	2	13332355	missense	probably benign	0.43
R8010:Cubn	UTSW	2	13336086	critical splice donor site	probably null
R8020:Cubn	UTSW	2	13479178	missense	probably benign	0.01
R8120:Cubn	UTSW	2	13331660	missense	probably damaging	1.00
R8133:Cubn	UTSW	2	13388848	missense	probably damaging	1.00
R8185:Cubn	UTSW	2	13294318	missense	probably benign	0.11
R8224:Cubn	UTSW	2	13349877	missense	probably benign	0.16
R8289:Cubn	UTSW	2	13486802	missense	probably benign	0.10
R8326:Cubn	UTSW	2	13306463	missense	probably benign	0.01
R8331:Cubn	UTSW	2	13340242	missense	probably damaging	1.00
R8338:Cubn	UTSW	2	13430847	missense	probably benign	0.08
R8341:Cubn	UTSW	2	13428724	missense	probably damaging	1.00
R8358:Cubn	UTSW	2	13325160	missense	probably benign	0.17
R8427:Cubn	UTSW	2	13428756	missense	probably benign	0.00
R8432:Cubn	UTSW	2	13381799	missense	probably benign	0.00
R8441:Cubn	UTSW	2	13427847	missense	probably damaging	1.00
R8442:Cubn	UTSW	2	13314044	missense	probably damaging	1.00
R8520:Cubn	UTSW	2	13308520	critical splice donor site	probably null
R8699:Cubn	UTSW	2	13383959	missense	probably damaging	1.00
R8753:Cubn	UTSW	2	13308566	nonsense	probably null
R8874:Cubn	UTSW	2	13360346	missense	possibly damaging	0.63
R9056:Cubn	UTSW	2	13456655	missense	probably damaging	1.00
R9079:Cubn	UTSW	2	13287103	missense	probably benign	0.02
R9143:Cubn	UTSW	2	13332465	splice site	probably benign
R9261:Cubn	UTSW	2	13278451	missense	probably damaging	1.00
R9338:Cubn	UTSW	2	13381892	missense	probably damaging	1.00
R9342:Cubn	UTSW	2	13458956	missense	probably damaging	0.99
R9603:Cubn	UTSW	2	13287699	missense	probably damaging	1.00
R9614:Cubn	UTSW	2	13478134	missense	probably benign	0.00
R9615:Cubn	UTSW	2	13321180	missense	possibly damaging	0.88
R9616:Cubn	UTSW	2	13314718	missense	probably benign	0.04
R9774:Cubn	UTSW	2	13428719	missense	probably benign
X0018:Cubn	UTSW	2	13458986	missense	probably damaging	1.00
X0022:Cubn	UTSW	2	13476076	missense	probably damaging	1.00
X0026:Cubn	UTSW	2	13342581	missense	probably damaging	1.00
X0063:Cubn	UTSW	2	13322962	missense	probably damaging	1.00
YA93:Cubn	UTSW	2	13383992	missense	probably benign	0.21
Z1088:Cubn	UTSW	2	13294229	missense	probably benign	0.43
Z1176:Cubn	UTSW	2	13381825	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TCAGCAAGGGAGGTTTTGTC -3'
(R):5'- TTTCCTAGGCCAGAGAAAGATG -3'

Sequencing Primer
(F):5'- CAGTGTCTGCAAATACGAC -3'
(R):5'- TCCTAGGCCAGAGAAAGATGTTAAAG -3'

Posted On

2019-09-13