Incidental Mutation 'R7223:Pcsk2'
ID561924
Institutional Source Beutler Lab
Gene Symbol Pcsk2
Ensembl Gene ENSMUSG00000027419
Gene Nameproprotein convertase subtilisin/kexin type 2
SynonymsPhpp-2, SPC2, Nec2, PC2, Nec-2, prohormone convertase 2, 6330411F23Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.215) question?
Stock #R7223 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location143546156-143816285 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 143690333 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 134 (T134A)
Ref Sequence ENSEMBL: ENSMUSP00000028905 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028905]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028905
AA Change: T134A

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000028905
Gene: ENSMUSG00000027419
AA Change: T134A

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:S8_pro-domain 32 108 2.9e-21 PFAM
Pfam:Peptidase_S8 157 444 5e-44 PFAM
Pfam:P_proprotein 503 590 4.3e-28 PFAM
low complexity region 617 630 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the subtilisin-like proprotein convertase family, which includes proteases that process protein and peptide precursors trafficking through regulated or constitutive branches of the secretory pathway. The protein undergoes an initial autocatalytic processing event and interacts with a neuroendocrine secretory protein in the ER, exits the ER and sorts to secretory granules, where it is cleaved and catalytically activated during intracellular transport. The encoded protease is packaged into and activated in dense core secretory granules and expressed in the neuroendocrine system and brain. This gene encodes one of the seven basic amino acid-specific members which cleave their substrates at single or paired basic residues. It functions in the proteolytic activation of polypeptide hormones and neuropeptides precursors. Single nucleotide polymorphisms in this gene may increase susceptibility to myocardial infarction and type 2 diabetes. This gene may also play a role in tumor development and progression. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2014]
PHENOTYPE: Mice homozygous for disruptions of this gene display abnormalities in the maturation of peptide hormones leading to reduced female fertility, increased blood pressure on a high salt diet, and abnormal glucose metabolism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb11 A T 2: 69,274,143 V733E probably benign Het
Adam34 A T 8: 43,652,004 N201K probably benign Het
Aldh3b2 A C 19: 3,979,592 S322R probably damaging Het
Anpep A T 7: 79,825,310 L914Q probably damaging Het
Arhgap30 T C 1: 171,407,571 F535S probably damaging Het
Baiap3 G A 17: 25,243,840 R1075C probably benign Het
Baz2a G T 10: 128,112,606 G252V probably damaging Het
Brinp3 T A 1: 146,901,074 S420T possibly damaging Het
Carmil3 T C 14: 55,496,238 F359S possibly damaging Het
Ccdc124 A T 8: 70,868,526 L190Q probably damaging Het
Ccr6 T C 17: 8,256,140 V59A probably damaging Het
Ccr8 T A 9: 120,094,617 I266N probably damaging Het
Cdh23 T A 10: 60,331,817 E1798V probably damaging Het
Cdk5rap2 T C 4: 70,235,447 N1713S probably benign Het
Cep19 T A 16: 32,104,015 I33N probably damaging Het
Cers3 A T 7: 66,783,415 Y196F probably damaging Het
Cidea T C 18: 67,366,421 I126T probably damaging Het
Copg2 A T 6: 30,812,754 Y546* probably null Het
Cul3 A T 1: 80,287,000 V261E probably benign Het
Cyp2g1 A T 7: 26,814,632 D221V probably damaging Het
Cyp8b1 G A 9: 121,915,097 H390Y probably damaging Het
Daam1 T C 12: 71,988,943 F971L probably damaging Het
Dnajc24 G A 2: 106,001,966 S24L possibly damaging Het
Dpysl3 T C 18: 43,438,042 S56G probably benign Het
Esp1 A G 17: 40,731,081 D88G probably benign Het
Fam171b A G 2: 83,878,230 T359A probably damaging Het
Fam186b T C 15: 99,279,837 E536G possibly damaging Het
Fbxo3 T C 2: 104,043,012 V156A possibly damaging Het
Gls2 C A 10: 128,199,194 H65Q probably benign Het
Gp2 A G 7: 119,451,498 probably null Het
Gpcpd1 T A 2: 132,534,056 K435I probably benign Het
Gpx6 T A 13: 21,317,670 probably null Het
Hps3 A T 3: 20,030,419 S202T probably benign Het
Htr1d T A 4: 136,443,501 L347H probably damaging Het
Igfals T C 17: 24,881,234 L433P probably damaging Het
Ilvbl C T 10: 78,583,696 H537Y probably benign Het
Iqgap2 A T 13: 95,628,972 M1530K probably damaging Het
Jarid2 A G 13: 44,896,322 T247A possibly damaging Het
L3hypdh C T 12: 72,074,009 V323I possibly damaging Het
Lama3 C T 18: 12,582,608 T1707I possibly damaging Het
Map6 G T 7: 99,268,025 A2S probably damaging Het
Mfap3 T A 11: 57,530,240 I349K probably benign Het
Mybl2 A G 2: 163,072,705 T248A probably benign Het
N6amt1 A G 16: 87,362,660 *151W probably null Het
Nhlrc1 A G 13: 47,014,208 V191A probably benign Het
Nkx2-5 T C 17: 26,839,620 E120G possibly damaging Het
Olfr1066 T A 2: 86,455,867 I135F possibly damaging Het
Olfr1380 T A 11: 49,564,098 M59K probably damaging Het
Olfr582 C A 7: 103,041,632 T46N possibly damaging Het
Olfr890 T C 9: 38,143,753 V201A probably benign Het
Pcdha8 T G 18: 36,993,148 L228V probably benign Het
Phldb3 G A 7: 24,624,653 R484Q probably benign Het
Pipox A G 11: 77,881,186 S371P probably damaging Het
Plekhg1 T C 10: 3,873,343 S159P Het
Psme4 C T 11: 30,874,226 P1737S probably benign Het
Pygm G A 19: 6,388,863 D328N probably benign Het
Rabgef1 A T 5: 130,190,960 E88V probably benign Het
Rims2 G T 15: 39,437,032 R245L probably benign Het
Slc38a4 T C 15: 97,010,345 I172V probably damaging Het
Slc4a10 T A 2: 62,268,665 Y586N probably damaging Het
Snap91 C T 9: 86,879,557 probably benign Het
Sorcs1 C T 19: 50,190,042 V881I probably benign Het
Spef2 A T 15: 9,601,640 V1512E unknown Het
Sufu T C 19: 46,453,277 I292T possibly damaging Het
Tet1 T C 10: 62,813,671 N87D possibly damaging Het
Tmem108 T C 9: 103,499,534 T239A not run Het
Tmem121 A T 12: 113,188,494 K111* probably null Het
Tpp2 T A 1: 43,968,888 D417E probably damaging Het
Tpr G A 1: 150,439,256 E2025K possibly damaging Het
Trappc3 C T 4: 126,275,152 A145V possibly damaging Het
Ttn T C 2: 76,890,981 D6754G probably null Het
Unc13c T A 9: 73,629,191 M1627L probably benign Het
Ush2a A G 1: 188,810,217 I3327V probably benign Het
Vmn1r74 C T 7: 11,846,967 Q65* probably null Het
Wdr18 G A 10: 79,960,368 R69H probably damaging Het
Zbed5 G T 5: 129,900,438 D132Y probably damaging Het
Zfp644 A T 5: 106,637,582 Y366* probably null Het
Zfyve26 T C 12: 79,246,171 N2068S probably damaging Het
Zic2 T C 14: 122,476,091 F139S probably damaging Het
Zmynd11 T C 13: 9,710,162 Q141R probably benign Het
Zrsr1 A G 11: 22,973,388 E54G probably benign Het
Zscan10 G A 17: 23,609,482 D333N probably benign Het
Other mutations in Pcsk2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Pcsk2 APN 2 143793239 missense probably damaging 1.00
IGL01609:Pcsk2 APN 2 143801158 missense possibly damaging 0.88
IGL01690:Pcsk2 APN 2 143687570 missense probably benign
IGL01833:Pcsk2 APN 2 143687580 missense possibly damaging 0.62
IGL01962:Pcsk2 APN 2 143813632 nonsense probably null
IGL02219:Pcsk2 APN 2 143793125 missense probably damaging 1.00
IGL02572:Pcsk2 APN 2 143690342 missense probably damaging 1.00
IGL02752:Pcsk2 APN 2 143773945 missense probably benign 0.09
P0035:Pcsk2 UTSW 2 143795951 missense probably damaging 1.00
R0092:Pcsk2 UTSW 2 143801024 missense probably damaging 1.00
R1424:Pcsk2 UTSW 2 143573428 splice site probably benign
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1470:Pcsk2 UTSW 2 143546518 nonsense probably null
R1832:Pcsk2 UTSW 2 143793269 missense probably damaging 1.00
R1993:Pcsk2 UTSW 2 143687619 missense probably benign 0.00
R4615:Pcsk2 UTSW 2 143795969 missense probably damaging 1.00
R4783:Pcsk2 UTSW 2 143687679 critical splice donor site probably null
R4796:Pcsk2 UTSW 2 143813425 missense probably benign 0.16
R4827:Pcsk2 UTSW 2 143801179 nonsense probably null
R5357:Pcsk2 UTSW 2 143573464 missense probably benign 0.00
R5413:Pcsk2 UTSW 2 143696700 splice site probably null
R5440:Pcsk2 UTSW 2 143546543 missense probably benign 0.22
R5546:Pcsk2 UTSW 2 143546560 missense probably benign 0.00
R5605:Pcsk2 UTSW 2 143749245 intron probably benign
R5821:Pcsk2 UTSW 2 143749115 splice site probably null
R5905:Pcsk2 UTSW 2 143749140 missense probably damaging 0.98
R6120:Pcsk2 UTSW 2 143801111 missense probably damaging 1.00
R6135:Pcsk2 UTSW 2 143573540 missense possibly damaging 0.63
R6657:Pcsk2 UTSW 2 143690366 missense probably damaging 1.00
R6925:Pcsk2 UTSW 2 143813747 missense probably damaging 1.00
R7289:Pcsk2 UTSW 2 143690423 missense probably damaging 1.00
R8043:Pcsk2 UTSW 2 143813530 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGCAATTTAGTTATGAGATGAGGG -3'
(R):5'- CCAACTCTTTGTGTTTGGAGGC -3'

Sequencing Primer
(F):5'- ATGAGGGGATTAGAGCAGTATTTG -3'
(R):5'- CTCTTTGTGTTTGGAGGCACGAAAG -3'
Posted On2019-06-26