Mutagenetix > Incidental Mutations

Incidental Mutation 'R7223:Anpep'

561938

Institutional Source

Beutler Lab

Gene Symbol

Anpep

Ensembl Gene

ENSMUSG00000039062

Gene Name

alanyl (membrane) aminopeptidase

Synonyms

aminopeptidase N, Cd13, Apn

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7223 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

79821803-79861059 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 79825310 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 914 (L914Q)

Ref Sequence

ENSEMBL: ENSMUSP00000035943 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049004] [ENSMUST00000107392] [ENSMUST00000205502]

Predicted Effect

probably damaging
Transcript: ENSMUST00000049004
AA Change: L914Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000035943
Gene: ENSMUSG00000039062
AA Change: L914Q

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	6.3e-142	PFAM
Pfam:Peptidase_MA_2	355	502	1.4e-21	PFAM
Pfam:ERAP1_C	618	944	2.9e-45	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000107392
AA Change: L914Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103015
Gene: ENSMUSG00000039062
AA Change: L914Q

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	44	64	N/A	INTRINSIC
Pfam:Peptidase_M1	75	479	2.5e-139	PFAM
Pfam:ERAP1_C	618	943	2e-73	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000205502
AA Change: L168Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminopeptidase N is located in the small-intestinal and renal microvillar membrane, and also in other plasma membranes. In the small intestine aminopeptidase N plays a role in the final digestion of peptides generated from hydrolysis of proteins by gastric and pancreatic proteases. Its function in proximal tubular epithelial cells and other cell types is less clear. The large extracellular carboxyterminal domain contains a pentapeptide consensus sequence characteristic of members of the zinc-binding metalloproteinase superfamily. Sequence comparisons with known enzymes of this class showed that CD13 and aminopeptidase N are identical. The latter enzyme was thought to be involved in the metabolism of regulatory peptides by diverse cell types, including small intestinal and renal tubular epithelial cells, macrophages, granulocytes, and synaptic membranes from the CNS. Human aminopeptidase N is a receptor for one strain of human coronavirus that is an important cause of upper respiratory tract infections. Defects in this gene appear to be a cause of various types of leukemia or lymphoma. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for different knock-out alleles exhibit an increase in CD4+ thymocytes, altered macrophage adhesion, pathological neovascularization and/or altered mammary gland morphology during gestation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb11	A	T	2: 69,274,143	V733E	probably benign	Het
Adam34	A	T	8: 43,652,004	N201K	probably benign	Het
Aldh3b2	A	C	19: 3,979,592	S322R	probably damaging	Het
Arhgap30	T	C	1: 171,407,571	F535S	probably damaging	Het
Baiap3	G	A	17: 25,243,840	R1075C	probably benign	Het
Baz2a	G	T	10: 128,112,606	G252V	probably damaging	Het
Brinp3	T	A	1: 146,901,074	S420T	possibly damaging	Het
Carmil3	T	C	14: 55,496,238	F359S	possibly damaging	Het
Ccdc124	A	T	8: 70,868,526	L190Q	probably damaging	Het
Ccr6	T	C	17: 8,256,140	V59A	probably damaging	Het
Ccr8	T	A	9: 120,094,617	I266N	probably damaging	Het
Cdh23	T	A	10: 60,331,817	E1798V	probably damaging	Het
Cdk5rap2	T	C	4: 70,235,447	N1713S	probably benign	Het
Cep19	T	A	16: 32,104,015	I33N	probably damaging	Het
Cers3	A	T	7: 66,783,415	Y196F	probably damaging	Het
Cidea	T	C	18: 67,366,421	I126T	probably damaging	Het
Copg2	A	T	6: 30,812,754	Y546*	probably null	Het
Cul3	A	T	1: 80,287,000	V261E	probably benign	Het
Cyp2g1	A	T	7: 26,814,632	D221V	probably damaging	Het
Cyp8b1	G	A	9: 121,915,097	H390Y	probably damaging	Het
Daam1	T	C	12: 71,988,943	F971L	probably damaging	Het
Dnajc24	G	A	2: 106,001,966	S24L	possibly damaging	Het
Dpysl3	T	C	18: 43,438,042	S56G	probably benign	Het
Esp1	A	G	17: 40,731,081	D88G	probably benign	Het
Fam171b	A	G	2: 83,878,230	T359A	probably damaging	Het
Fam186b	T	C	15: 99,279,837	E536G	possibly damaging	Het
Fbxo3	T	C	2: 104,043,012	V156A	possibly damaging	Het
Gls2	C	A	10: 128,199,194	H65Q	probably benign	Het
Gp2	A	G	7: 119,451,498		probably null	Het
Gpcpd1	T	A	2: 132,534,056	K435I	probably benign	Het
Gpx6	T	A	13: 21,317,670		probably null	Het
Hps3	A	T	3: 20,030,419	S202T	probably benign	Het
Htr1d	T	A	4: 136,443,501	L347H	probably damaging	Het
Igfals	T	C	17: 24,881,234	L433P	probably damaging	Het
Ilvbl	C	T	10: 78,583,696	H537Y	probably benign	Het
Iqgap2	A	T	13: 95,628,972	M1530K	probably damaging	Het
Jarid2	A	G	13: 44,896,322	T247A	possibly damaging	Het
L3hypdh	C	T	12: 72,074,009	V323I	possibly damaging	Het
Lama3	C	T	18: 12,582,608	T1707I	possibly damaging	Het
Map6	G	T	7: 99,268,025	A2S	probably damaging	Het
Mfap3	T	A	11: 57,530,240	I349K	probably benign	Het
Mybl2	A	G	2: 163,072,705	T248A	probably benign	Het
N6amt1	A	G	16: 87,362,660	*151W	probably null	Het
Nhlrc1	A	G	13: 47,014,208	V191A	probably benign	Het
Nkx2-5	T	C	17: 26,839,620	E120G	possibly damaging	Het
Olfr1066	T	A	2: 86,455,867	I135F	possibly damaging	Het
Olfr1380	T	A	11: 49,564,098	M59K	probably damaging	Het
Olfr582	C	A	7: 103,041,632	T46N	possibly damaging	Het
Olfr890	T	C	9: 38,143,753	V201A	probably benign	Het
Pcdha8	T	G	18: 36,993,148	L228V	probably benign	Het
Pcsk2	A	G	2: 143,690,333	T134A	possibly damaging	Het
Phldb3	G	A	7: 24,624,653	R484Q	probably benign	Het
Pipox	A	G	11: 77,881,186	S371P	probably damaging	Het
Plekhg1	T	C	10: 3,873,343	S159P		Het
Psme4	C	T	11: 30,874,226	P1737S	probably benign	Het
Pygm	G	A	19: 6,388,863	D328N	probably benign	Het
Rabgef1	A	T	5: 130,190,960	E88V	probably benign	Het
Rims2	G	T	15: 39,437,032	R245L	probably benign	Het
Slc38a4	T	C	15: 97,010,345	I172V	probably damaging	Het
Slc4a10	T	A	2: 62,268,665	Y586N	probably damaging	Het
Snap91	C	T	9: 86,879,557		probably benign	Het
Sorcs1	C	T	19: 50,190,042	V881I	probably benign	Het
Spef2	A	T	15: 9,601,640	V1512E	unknown	Het
Sufu	T	C	19: 46,453,277	I292T	possibly damaging	Het
Tet1	T	C	10: 62,813,671	N87D	possibly damaging	Het
Tmem108	T	C	9: 103,499,534	T239A	not run	Het
Tmem121	A	T	12: 113,188,494	K111*	probably null	Het
Tpp2	T	A	1: 43,968,888	D417E	probably damaging	Het
Tpr	G	A	1: 150,439,256	E2025K	possibly damaging	Het
Trappc3	C	T	4: 126,275,152	A145V	possibly damaging	Het
Ttn	T	C	2: 76,890,981	D6754G	probably null	Het
Unc13c	T	A	9: 73,629,191	M1627L	probably benign	Het
Ush2a	A	G	1: 188,810,217	I3327V	probably benign	Het
Vmn1r74	C	T	7: 11,846,967	Q65*	probably null	Het
Wdr18	G	A	10: 79,960,368	R69H	probably damaging	Het
Zbed5	G	T	5: 129,900,438	D132Y	probably damaging	Het
Zfp644	A	T	5: 106,637,582	Y366*	probably null	Het
Zfyve26	T	C	12: 79,246,171	N2068S	probably damaging	Het
Zic2	T	C	14: 122,476,091	F139S	probably damaging	Het
Zmynd11	T	C	13: 9,710,162	Q141R	probably benign	Het
Zrsr1	A	G	11: 22,973,388	E54G	probably benign	Het
Zscan10	G	A	17: 23,609,482	D333N	probably benign	Het

Other mutations in Anpep

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00088:Anpep	APN	7	79825736	missense	possibly damaging	0.64
IGL00089:Anpep	APN	7	79841986	missense	probably damaging	1.00
IGL00767:Anpep	APN	7	79840890	missense	probably benign	0.00
IGL00901:Anpep	APN	7	79839423	missense	probably benign
IGL01919:Anpep	APN	7	79825350	missense	possibly damaging	0.77
IGL02049:Anpep	APN	7	79835181	missense	probably damaging	0.97
IGL02195:Anpep	APN	7	79826685	missense	probably damaging	1.00
IGL02210:Anpep	APN	7	79826904	missense	probably benign	0.00
IGL02584:Anpep	APN	7	79825393	splice site	probably benign
IGL02677:Anpep	APN	7	79838730	missense	probably damaging	1.00
IGL03073:Anpep	APN	7	79838955	missense	probably damaging	1.00
IGL03100:Anpep	APN	7	79836361	missense	probably benign	0.01
PIT4696001:Anpep	UTSW	7	79839464	missense	possibly damaging	0.85
R0329:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0330:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R0619:Anpep	UTSW	7	79841009	missense	probably benign
R0691:Anpep	UTSW	7	79839299	missense	probably damaging	0.98
R1004:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1005:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1274:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1288:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1289:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1532:Anpep	UTSW	7	79826948	nonsense	probably null
R1540:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1574:Anpep	UTSW	7	79838407	splice site	probably null
R1618:Anpep	UTSW	7	79835417	missense	probably benign	0.00
R1627:Anpep	UTSW	7	79842011	missense	probably benign
R1693:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1717:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1745:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1746:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1748:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1809:Anpep	UTSW	7	79841823	missense	probably benign	0.01
R1901:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1902:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1903:Anpep	UTSW	7	79838256	missense	probably benign	0.01
R1985:Anpep	UTSW	7	79840857	splice site	probably null
R2379:Anpep	UTSW	7	79841218	missense	probably benign	0.28
R2508:Anpep	UTSW	7	79838291	missense	possibly damaging	0.80
R3110:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3112:Anpep	UTSW	7	79841972	missense	probably benign	0.15
R3898:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3899:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R3900:Anpep	UTSW	7	79839225	missense	probably benign	0.07
R4211:Anpep	UTSW	7	79840996	nonsense	probably null
R4701:Anpep	UTSW	7	79839465	missense	probably benign	0.16
R4716:Anpep	UTSW	7	79826632	missense	probably benign	0.00
R5020:Anpep	UTSW	7	79833727	missense	probably benign
R5042:Anpep	UTSW	7	79839469	missense	probably benign	0.00
R5084:Anpep	UTSW	7	79826870	critical splice donor site	probably null
R5319:Anpep	UTSW	7	79841731	missense	probably benign
R5593:Anpep	UTSW	7	79842046	missense	probably benign	0.04
R5778:Anpep	UTSW	7	79836391	missense	probably benign	0.00
R5852:Anpep	UTSW	7	79838972	nonsense	probably null
R5906:Anpep	UTSW	7	79833675	missense	probably benign
R6164:Anpep	UTSW	7	79842205	missense	possibly damaging	0.68
R6254:Anpep	UTSW	7	79839233	missense	probably damaging	1.00
R6284:Anpep	UTSW	7	79825802	missense	probably damaging	1.00
R6380:Anpep	UTSW	7	79841896	missense	probably benign	0.04
R6594:Anpep	UTSW	7	79841361	splice site	probably null
R6746:Anpep	UTSW	7	79839185	splice site	probably null
R6920:Anpep	UTSW	7	79825349	missense	probably damaging	1.00
R7060:Anpep	UTSW	7	79841794	missense	probably benign	0.33
R7072:Anpep	UTSW	7	79835379	missense	possibly damaging	0.58
R7095:Anpep	UTSW	7	79842202	missense	possibly damaging	0.87
R7102:Anpep	UTSW	7	79836313	missense	probably benign	0.00
R7178:Anpep	UTSW	7	79840988	missense	probably benign
R7344:Anpep	UTSW	7	79838650	missense	possibly damaging	0.60
R7441:Anpep	UTSW	7	79827644	missense	possibly damaging	0.93
R7479:Anpep	UTSW	7	79835370	missense	probably benign	0.11
R7503:Anpep	UTSW	7	79826637	missense	probably damaging	1.00
R7683:Anpep	UTSW	7	79839198	missense	probably damaging	0.98
R7912:Anpep	UTSW	7	79838426	missense	probably benign	0.00
R7935:Anpep	UTSW	7	79826961	missense	possibly damaging	0.46
R8036:Anpep	UTSW	7	79841898	missense	probably benign	0.11
R8039:Anpep	UTSW	7	79839400	critical splice donor site	probably null
R8470:Anpep	UTSW	7	79839521	missense	probably benign	0.16
R8549:Anpep	UTSW	7	79840896	missense	probably benign	0.00
R8723:Anpep	UTSW	7	79838938	missense	probably damaging	1.00
R8726:Anpep	UTSW	7	79840893	missense	probably benign	0.00
Z1176:Anpep	UTSW	7	79827639	missense	possibly damaging	0.90

Predicted Primers

PCR Primer
(F):5'- TAGTTACTTCGGAGACTCGGG -3'
(R):5'- TCCCTCACAGAATGGTTGTG -3'

Sequencing Primer
(F):5'- AGTGCTAGAGCCCAGGAGC -3'
(R):5'- GGGGTGCTATAGTTTCCTGACACC -3'

Posted On

2019-06-26