Mutagenetix > Incidental Mutation

Incidental Mutation 'R7399:Nup205'

574023

Institutional Source

Beutler Lab

Gene Symbol

Nup205

Ensembl Gene

ENSMUSG00000038759

Gene Name

nucleoporin 205

Synonyms

3830404O05Rik

MMRRC Submission

045481-MU

Accession Numbers

NCBI RefSeq: NM_027513.1; MGI:2141625

Essential gene?

Probably essential (E-score: 0.962) question?

Stock #

R7399 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

35177421-35247596 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 35214676 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1032 (I1032N)

Ref Sequence

ENSEMBL: ENSMUSP00000144126 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000043815] [ENSMUST00000170234] [ENSMUST00000201374]

AlphaFold

A0A0J9YUD5

Predicted Effect

probably damaging
Transcript: ENSMUST00000043815
AA Change: I979N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000039656
Gene: ENSMUSG00000038759
AA Change: I979N

Domain	Start	End	E-Value	Type
low complexity region	2	13	N/A	INTRINSIC
Pfam:Nup192	14	1684	N/A	PFAM
low complexity region	1995	2005	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000170234

SMART Domains

Protein: ENSMUSP00000130033
Gene: ENSMUSG00000038759

Domain	Start	End	E-Value	Type
Pfam:DUF3414	13	322	9.7e-98	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000201374
AA Change: I1032N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000144126
Gene: ENSMUSG00000038759
AA Change: I1032N

Domain	Start	End	E-Value	Type
low complexity region	36	50	N/A	INTRINSIC
Pfam:Nup192	67	1737	N/A	PFAM
low complexity region	2048	2058	N/A	INTRINSIC

Meta Mutation Damage Score

0.5835

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 99.0%

Validation Efficiency

99% (74/75)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleoporin, which is a subunit of the nuclear pore complex that functions in active transport of proteins, RNAs and ribonucleoprotein particles between the nucleus and cytoplasm. Mutations in this gene are associated with steroid-resistant nephrotic syndrome. [provided by RefSeq, Jul 2016]

Allele List at MGI

All alleles(32) : Targeted(2) Gene trapped(30)

Other mutations in this stock

Total: 74 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acaca	T	G	11: 84,260,679	V801G	possibly damaging	Het
Actbl2	T	A	13: 111,255,593	M154K	probably benign	Het
Adam7	A	T	14: 68,504,466		probably null	Het
Arfgef1	T	A	1: 10,180,897	T888S	probably benign	Het
AW554918	C	T	18: 25,169,060	P10L	possibly damaging	Het
Bcap29	A	G	12: 31,630,882	I35T	probably damaging	Het
Bhlhe40	TG	TGG	6: 108,664,857	254	probably null	Het
C87499	C	A	4: 88,627,965	R380L	probably benign	Het
Cdc25b	A	G	2: 131,194,654	D458G	probably damaging	Het
Cdc42bpb	T	C	12: 111,305,667	K1104R	probably benign	Het
Cep89	A	G	7: 35,438,378	N729S	probably damaging	Het
Clec4a4	T	A	6: 122,991,829	M51K	possibly damaging	Het
Dcdc2b	A	G	4: 129,609,629	L270P	probably damaging	Het
Dennd5b	G	T	6: 149,036,483	H639N	probably damaging	Het
Dnah11	T	G	12: 118,027,477	T2385P	probably benign	Het
Dnah11	T	C	12: 118,125,785	E1182G	probably damaging	Het
Dok7	T	C	5: 35,066,471	V81A	probably damaging	Het
Dtx1	T	A	5: 120,682,393	M494L	possibly damaging	Het
Foxj1	A	T	11: 116,332,254	L241Q	possibly damaging	Het
Gbp10	G	A	5: 105,236,149		probably benign	Het
Hnmt	T	A	2: 24,003,880	T201S	probably benign	Het
Jup	G	T	11: 100,378,351	T412K	possibly damaging	Het
Kcnh2	G	A	5: 24,322,059	S954F	probably damaging	Het
Klhdc7b	A	C	15: 89,388,644	K585T	possibly damaging	Het
Klk7	T	A	7: 43,812,000	S14T	probably benign	Het
Lama4	G	A	10: 39,047,948	E451K	probably damaging	Het
Ldhb	A	G	6: 142,495,673	C164R	probably damaging	Het
Malrd1	G	A	2: 15,610,090	D239N		Het
Mgam	T	A	6: 40,666,854	V572E	probably damaging	Het
Mrgprb2	G	T	7: 48,552,142	N278K	probably damaging	Het
Msto1	A	G	3: 88,911,823	Y206H	probably damaging	Het
Myo6	A	G	9: 80,262,291	S467G	unknown	Het
Mysm1	T	A	4: 94,961,727	I447L	probably benign	Het
Nav3	T	C	10: 109,852,934	E494G	possibly damaging	Het
Nol10	T	G	12: 17,402,173	V376G	probably damaging	Het
Olfr1002	T	A	2: 85,647,424	D299V	possibly damaging	Het
Olfr1100	G	A	2: 86,978,157	T213I	probably benign	Het
Olfr1170	A	T	2: 88,225,022	Y3*	probably null	Het
Olfr1450	A	G	19: 12,954,447	N286S	probably damaging	Het
Olfr449	T	G	6: 42,838,746	Y288*	probably null	Het
Olfr455	A	G	6: 42,538,728	F98S	possibly damaging	Het
Olfr617	A	T	7: 103,584,381	I120L	possibly damaging	Het
Olfr782	A	T	10: 129,350,557		probably benign	Het
Olfr996	A	G	2: 85,579,296	D19G	probably benign	Het
Oog2	A	G	4: 144,195,281	K254E	probably benign	Het
Osbpl11	T	A	16: 33,236,279	D694E	probably benign	Het
Pcm1	T	A	8: 41,293,510	Y1210N	probably benign	Het
Pdxk	T	C	10: 78,440,863	M293V	probably benign	Het
Plcb3	T	C	19: 6,962,867	I451V	probably benign	Het
Plekhm2	A	G	4: 141,634,376	F272S	probably damaging	Het
Ptgdr	A	T	14: 44,858,232		probably null	Het
Ptprf	C	T	4: 118,226,523	V788I	probably benign	Het
Ralbp1	C	T	17: 65,854,148	V467I	probably benign	Het
Ralgds	A	C	2: 28,543,655	Q229P	possibly damaging	Het
Recql	T	C	6: 142,374,884	D146G	probably damaging	Het
Reln	T	C	5: 22,051,367	N493S	probably damaging	Het
Rfxank	C	T	8: 70,135,286		probably null	Het
Scn5a	A	T	9: 119,486,530	M1704K	probably damaging	Het
Slc7a7	G	T	14: 54,374,268	A316E	possibly damaging	Het
Slco1a6	A	T	6: 142,091,068	C538S	probably benign	Het
Spert	A	G	14: 75,592,637	S39P	probably benign	Het
Stard6	T	C	18: 70,498,647		probably null	Het
Strip2	T	A	6: 29,927,613	M219K	possibly damaging	Het
Tcam1	T	C	11: 106,284,085	V122A	probably damaging	Het
Tha1	A	G	11: 117,869,690	V236A	possibly damaging	Het
Tmem201	A	T	4: 149,731,097	I132N	possibly damaging	Het
Tnc	T	C	4: 64,020,657		probably benign	Het
Vmn1r42	T	C	6: 89,845,513	T25A	probably benign	Het
Vmn2r94	T	A	17: 18,244,503		probably null	Het
Wdfy4	A	C	14: 33,068,906	V2188G		Het
Zfp623	T	C	15: 75,947,398	S68P	probably damaging	Het
Zfp950	A	T	19: 61,119,155	C497S	probably damaging	Het
Zkscan2	C	T	7: 123,480,104	E877K	probably damaging	Het
Zp3r	C	A	1: 130,577,053	V536L	probably damaging	Het

Other mutations in Nup205

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Nup205	APN	6	35214802	missense	probably damaging	1.00
IGL01086:Nup205	APN	6	35208936	splice site	probably benign
IGL01138:Nup205	APN	6	35208084	nonsense	probably null
IGL01333:Nup205	APN	6	35241063	missense	probably benign
IGL01399:Nup205	APN	6	35219689	missense	possibly damaging	0.80
IGL01466:Nup205	APN	6	35199959	missense	probably benign	0.08
IGL01913:Nup205	APN	6	35227430	missense	probably benign	0.10
IGL02159:Nup205	APN	6	35189178	missense	probably damaging	1.00
IGL02442:Nup205	APN	6	35190068	missense	probably benign	0.01
IGL02447:Nup205	APN	6	35227576	splice site	probably null
IGL02558:Nup205	APN	6	35189924	missense	probably damaging	1.00
IGL03306:Nup205	APN	6	35208169	missense	probably damaging	0.98
IGL03328:Nup205	APN	6	35232414	missense	probably damaging	0.99
Figaro	UTSW	6	35196714	splice site	probably null
Marcellina	UTSW	6	35183969	missense	probably damaging	1.00
Spirit	UTSW	6	35232408	missense	probably damaging	0.98
Susanna	UTSW	6	35208109	missense	possibly damaging	0.94
voyager	UTSW	6	35189885	missense	possibly damaging	0.80
BB007:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
BB017:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
P0012:Nup205	UTSW	6	35196543	missense	possibly damaging	0.90
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0102:Nup205	UTSW	6	35225780	splice site	probably benign
R0362:Nup205	UTSW	6	35196714	splice site	probably null
R0374:Nup205	UTSW	6	35208837	missense	probably damaging	1.00
R0415:Nup205	UTSW	6	35214634	splice site	probably benign
R0427:Nup205	UTSW	6	35194463	missense	probably benign	0.01
R0543:Nup205	UTSW	6	35198969	missense	probably benign
R0611:Nup205	UTSW	6	35225968	missense	probably null	1.00
R0761:Nup205	UTSW	6	35196428	splice site	probably benign
R0828:Nup205	UTSW	6	35194566	missense	probably benign
R0906:Nup205	UTSW	6	35236892	missense	probably damaging	1.00
R1023:Nup205	UTSW	6	35234706	missense	probably damaging	0.98
R1033:Nup205	UTSW	6	35227442	missense	probably benign
R1375:Nup205	UTSW	6	35200071	splice site	probably benign
R1447:Nup205	UTSW	6	35215185	missense	probably benign	0.00
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1468:Nup205	UTSW	6	35225982	critical splice donor site	probably null
R1625:Nup205	UTSW	6	35191943	missense	probably benign	0.31
R1652:Nup205	UTSW	6	35238966	missense	probably benign
R1659:Nup205	UTSW	6	35234788	missense	probably benign	0.02
R1693:Nup205	UTSW	6	35210971	missense	probably benign	0.05
R1769:Nup205	UTSW	6	35205431	missense	probably damaging	1.00
R1839:Nup205	UTSW	6	35219714	missense	probably benign	0.00
R1959:Nup205	UTSW	6	35233366	missense	probably benign	0.16
R2051:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R2267:Nup205	UTSW	6	35241349	missense	possibly damaging	0.67
R2401:Nup205	UTSW	6	35208134	nonsense	probably null
R3697:Nup205	UTSW	6	35188711	missense	probably benign	0.15
R3938:Nup205	UTSW	6	35219742	missense	probably damaging	1.00
R4074:Nup205	UTSW	6	35192040	critical splice donor site	probably null
R4117:Nup205	UTSW	6	35241012	nonsense	probably null
R4364:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4366:Nup205	UTSW	6	35192027	missense	probably benign	0.38
R4594:Nup205	UTSW	6	35196489	missense	probably benign	0.00
R4706:Nup205	UTSW	6	35202008	missense	probably damaging	1.00
R4787:Nup205	UTSW	6	35202061	missense	probably damaging	1.00
R4849:Nup205	UTSW	6	35230570	missense	possibly damaging	0.90
R4850:Nup205	UTSW	6	35230530	missense	probably benign	0.16
R4943:Nup205	UTSW	6	35224639	missense	probably damaging	1.00
R4966:Nup205	UTSW	6	35243849	missense	probably benign	0.00
R5138:Nup205	UTSW	6	35225866	missense	probably damaging	1.00
R5251:Nup205	UTSW	6	35196482	splice site	probably null
R5444:Nup205	UTSW	6	35189189	missense	probably damaging	0.98
R5760:Nup205	UTSW	6	35247343	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35227680	missense	probably damaging	1.00
R5762:Nup205	UTSW	6	35230548	missense	probably damaging	0.96
R5941:Nup205	UTSW	6	35232408	missense	probably damaging	0.98
R5969:Nup205	UTSW	6	35177578	unclassified	probably benign
R6003:Nup205	UTSW	6	35212816	missense	probably benign
R6178:Nup205	UTSW	6	35243843	missense	possibly damaging	0.85
R6315:Nup205	UTSW	6	35236869	missense	probably damaging	1.00
R6392:Nup205	UTSW	6	35189885	missense	possibly damaging	0.80
R6710:Nup205	UTSW	6	35247373	missense	probably benign	0.00
R6954:Nup205	UTSW	6	35208109	missense	possibly damaging	0.94
R7022:Nup205	UTSW	6	35243936	missense	probably benign	0.45
R7041:Nup205	UTSW	6	35224535	missense	possibly damaging	0.49
R7052:Nup205	UTSW	6	35215142	missense	possibly damaging	0.81
R7310:Nup205	UTSW	6	35225969	missense	possibly damaging	0.78
R7363:Nup205	UTSW	6	35232573	missense	probably benign	0.28
R7428:Nup205	UTSW	6	35227559	missense	probably damaging	1.00
R7553:Nup205	UTSW	6	35201999	missense	probably damaging	1.00
R7665:Nup205	UTSW	6	35177620	missense	possibly damaging	0.46
R7841:Nup205	UTSW	6	35247437	missense	unknown
R7930:Nup205	UTSW	6	35194576	missense	probably damaging	0.98
R7973:Nup205	UTSW	6	35245339	missense	probably benign
R7976:Nup205	UTSW	6	35198953	missense	probably damaging	1.00
R8073:Nup205	UTSW	6	35202169	critical splice donor site	probably null
R8080:Nup205	UTSW	6	35227376	missense	probably damaging	1.00
R8118:Nup205	UTSW	6	35230516	missense	probably benign	0.29
R8213:Nup205	UTSW	6	35225203	missense	probably benign	0.26
R8237:Nup205	UTSW	6	35227503	missense	possibly damaging	0.89
R8408:Nup205	UTSW	6	35225247	missense	probably damaging	1.00
R8807:Nup205	UTSW	6	35183969	missense	probably damaging	1.00
R8812:Nup205	UTSW	6	35214334	missense	probably damaging	1.00
R9061:Nup205	UTSW	6	35219873	intron	probably benign
R9261:Nup205	UTSW	6	35199857	missense	probably benign	0.00
R9403:Nup205	UTSW	6	35199974	missense	probably benign	0.45
R9648:Nup205	UTSW	6	35225811	missense	probably benign	0.00
R9744:Nup205	UTSW	6	35232575	missense	probably damaging	0.99
R9800:Nup205	UTSW	6	35186533	missense	possibly damaging	0.85
Z1177:Nup205	UTSW	6	35177605	missense	unknown
Z1177:Nup205	UTSW	6	35208793	critical splice acceptor site	probably null

Predicted Primers

PCR Primer
(F):5'- CATGGCATAATGAGGAAAACCTTG -3'
(R):5'- CAGCAAACATGTTAAATAGTTGCCC -3'

Sequencing Primer
(F):5'- GCATAATGAGGAAAACCTTGAAACTC -3'
(R):5'- GCCCATGTGTGGTACAGCTATAC -3'

Posted On

2019-09-13