Incidental Mutation 'R7439:Plekhg5'
ID576807
Institutional Source Beutler Lab
Gene Symbol Plekhg5
Ensembl Gene ENSMUSG00000039713
Gene Namepleckstrin homology domain containing, family G (with RhoGef domain) member 5
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location152072498-152115400 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 152113935 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 860 (V860D)
Ref Sequence ENSEMBL: ENSMUSP00000101286 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000035275] [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]
Predicted Effect probably benign
Transcript: ENSMUST00000025706
SMART Domains Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
TNFR 38 75 4.12e0 SMART
TNFR 78 120 3.78e-5 SMART
transmembrane domain 196 218 N/A INTRINSIC
DEATH 315 407 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000035275
SMART Domains Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

DomainStartEndE-ValueType
signal peptide 1 43 N/A INTRINSIC
TNFR 51 88 4.12e0 SMART
TNFR 91 133 3.78e-5 SMART
transmembrane domain 172 194 N/A INTRINSIC
DEATH 291 383 6.04e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000084115
AA Change: V860D

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: V860D

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105661
AA Change: V860D

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: V860D

DomainStartEndE-ValueType
low complexity region 314 334 N/A INTRINSIC
low complexity region 369 380 N/A INTRINSIC
RhoGEF 410 597 5.21e-53 SMART
PH 655 756 7.35e-12 SMART
low complexity region 778 790 N/A INTRINSIC
low complexity region 895 934 N/A INTRINSIC
low complexity region 1060 1069 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105662
AA Change: V828D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: V828D

DomainStartEndE-ValueType
low complexity region 282 302 N/A INTRINSIC
low complexity region 337 348 N/A INTRINSIC
RhoGEF 378 565 5.21e-53 SMART
PH 623 724 7.35e-12 SMART
low complexity region 746 758 N/A INTRINSIC
low complexity region 863 902 N/A INTRINSIC
low complexity region 1028 1037 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118648
AA Change: V847D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: V847D

DomainStartEndE-ValueType
low complexity region 301 321 N/A INTRINSIC
low complexity region 356 367 N/A INTRINSIC
RhoGEF 397 584 5.21e-53 SMART
PH 642 743 7.35e-12 SMART
low complexity region 765 777 N/A INTRINSIC
low complexity region 882 921 N/A INTRINSIC
low complexity region 1047 1056 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Zfp52 A T 17: 21,560,870 R327* probably null Het
Other mutations in Plekhg5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Plekhg5 APN 4 152102041 splice site probably null
IGL01025:Plekhg5 APN 4 152108526 missense probably damaging 1.00
IGL01062:Plekhg5 APN 4 152108496 missense probably damaging 1.00
IGL01138:Plekhg5 APN 4 152106978 missense probably damaging 1.00
IGL01301:Plekhg5 APN 4 152112553 missense probably benign
IGL02372:Plekhg5 APN 4 152102080 missense probably damaging 0.96
IGL02701:Plekhg5 APN 4 152103022 missense probably damaging 1.00
ANU18:Plekhg5 UTSW 4 152112553 missense probably benign
R0005:Plekhg5 UTSW 4 152112651 small deletion probably benign
R0012:Plekhg5 UTSW 4 152104750 missense probably benign 0.20
R0050:Plekhg5 UTSW 4 152108088 critical splice donor site probably null
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0233:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0234:Plekhg5 UTSW 4 152112219 missense probably damaging 1.00
R0346:Plekhg5 UTSW 4 152114253 missense probably benign 0.08
R0555:Plekhg5 UTSW 4 152107469 nonsense probably null
R0631:Plekhg5 UTSW 4 152112419 missense possibly damaging 0.89
R0639:Plekhg5 UTSW 4 152114120 missense probably benign 0.19
R1372:Plekhg5 UTSW 4 152104731 missense probably damaging 0.99
R1563:Plekhg5 UTSW 4 152096809 missense probably benign 0.33
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2870:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2871:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2872:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R2873:Plekhg5 UTSW 4 152107503 missense probably benign 0.01
R3104:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3106:Plekhg5 UTSW 4 152112178 missense probably damaging 1.00
R3408:Plekhg5 UTSW 4 152108292 missense probably damaging 1.00
R4289:Plekhg5 UTSW 4 152112427 missense probably benign 0.05
R5157:Plekhg5 UTSW 4 152107865 splice site probably benign
R5643:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5644:Plekhg5 UTSW 4 152104340 missense probably benign 0.14
R5790:Plekhg5 UTSW 4 152113935 missense probably benign
R6770:Plekhg5 UTSW 4 152103079 missense probably benign
R7027:Plekhg5 UTSW 4 152113974 missense probably benign 0.01
R7039:Plekhg5 UTSW 4 152107785 missense possibly damaging 0.90
R7092:Plekhg5 UTSW 4 152114508 missense probably damaging 1.00
R7309:Plekhg5 UTSW 4 152112528 missense possibly damaging 0.50
R7319:Plekhg5 UTSW 4 152108428 missense probably benign 0.13
R7543:Plekhg5 UTSW 4 152108034 missense probably damaging 1.00
R7662:Plekhg5 UTSW 4 152104298 missense probably damaging 1.00
R8271:Plekhg5 UTSW 4 152103007 missense probably damaging 1.00
R8322:Plekhg5 UTSW 4 152104744 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- TAGATAATCTGGCTTTCTGACTCTC -3'
(R):5'- ATTTGGACTTGAGCAGGCGG -3'

Sequencing Primer
(F):5'- AATCTGGCTTTCTGACTCTCTTCTG -3'
(R):5'- CAGCTGGACAGGAGTGC -3'
Posted On2019-10-07