Mutagenetix > Incidental Mutation

Incidental Mutation 'R7439:Plekhg5'

576807

Institutional Source

Beutler Lab

Gene Symbol

Plekhg5

Ensembl Gene

ENSMUSG00000039713

Gene Name

pleckstrin homology domain containing, family G (with RhoGef domain) member 5

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.150) question?

Stock #

R7439 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

152072498-152115400 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 152113935 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 860 (V860D)

Ref Sequence

ENSEMBL: ENSMUSP00000101286 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025706] [ENSMUST00000035275] [ENSMUST00000084115] [ENSMUST00000105661] [ENSMUST00000105662] [ENSMUST00000118648]

AlphaFold

Q66T02

Predicted Effect

probably benign
Transcript: ENSMUST00000025706

SMART Domains

Protein: ENSMUSP00000025706
Gene: ENSMUSG00000024793

Domain	Start	End	E-Value	Type
signal peptide	1	30	N/A	INTRINSIC
TNFR	38	75	4.12e0	SMART
TNFR	78	120	3.78e-5	SMART
transmembrane domain	196	218	N/A	INTRINSIC
DEATH	315	407	6.04e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000035275

SMART Domains

Protein: ENSMUSP00000047823
Gene: ENSMUSG00000024793

Domain	Start	End	E-Value	Type
signal peptide	1	43	N/A	INTRINSIC
TNFR	51	88	4.12e0	SMART
TNFR	91	133	3.78e-5	SMART
transmembrane domain	172	194	N/A	INTRINSIC
DEATH	291	383	6.04e-22	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000084115
AA Change: V860D

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000081132
Gene: ENSMUSG00000039713
AA Change: V860D

Domain	Start	End	E-Value	Type
low complexity region	314	334	N/A	INTRINSIC
low complexity region	369	380	N/A	INTRINSIC
RhoGEF	410	597	5.21e-53	SMART
PH	655	756	7.35e-12	SMART
low complexity region	778	790	N/A	INTRINSIC
low complexity region	895	934	N/A	INTRINSIC
low complexity region	1060	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105661
AA Change: V860D

PolyPhen 2 Score 0.185 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000101286
Gene: ENSMUSG00000039713
AA Change: V860D

Domain	Start	End	E-Value	Type
low complexity region	314	334	N/A	INTRINSIC
low complexity region	369	380	N/A	INTRINSIC
RhoGEF	410	597	5.21e-53	SMART
PH	655	756	7.35e-12	SMART
low complexity region	778	790	N/A	INTRINSIC
low complexity region	895	934	N/A	INTRINSIC
low complexity region	1060	1069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000105662
AA Change: V828D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000101287
Gene: ENSMUSG00000039713
AA Change: V828D

Domain	Start	End	E-Value	Type
low complexity region	282	302	N/A	INTRINSIC
low complexity region	337	348	N/A	INTRINSIC
RhoGEF	378	565	5.21e-53	SMART
PH	623	724	7.35e-12	SMART
low complexity region	746	758	N/A	INTRINSIC
low complexity region	863	902	N/A	INTRINSIC
low complexity region	1028	1037	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000118648
AA Change: V847D

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000112707
Gene: ENSMUSG00000039713
AA Change: V847D

Domain	Start	End	E-Value	Type
low complexity region	301	321	N/A	INTRINSIC
low complexity region	356	367	N/A	INTRINSIC
RhoGEF	397	584	5.21e-53	SMART
PH	642	743	7.35e-12	SMART
low complexity region	765	777	N/A	INTRINSIC
low complexity region	882	921	N/A	INTRINSIC
low complexity region	1047	1056	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a protein belonging to the Rho guanine exchange factor (GEF) family of proteins, which activate GTPases by replacing GDP with GTP. This family member is a RhoA GEF that plays a role in endothelial cell migration and tube formation. It is required for angiogenesis and may function in neuronal cell differentiation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Oct 2013]
PHENOTYPE: Mice homozygous for a knock-out allele display angiogenic defects that affect multiple organs, including sparser coronary and kidney arterial systems that appear to deficient in small diameter vessels while the major coronary and kidney arteries remain intact. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9530003J23Rik	G	A	10: 117,238,697		probably benign	Het
Acacb	T	C	5: 114,195,642	V542A	possibly damaging	Het
Adprhl1	C	T	8: 13,223,069	V1230I	probably benign	Het
Agpat1	T	A	17: 34,610,909	Y77N	probably damaging	Het
Apc	T	A	18: 34,312,073	I674K	probably damaging	Het
Arpc5	T	C	1: 152,771,436	S97P	probably damaging	Het
Arrdc5	A	G	17: 56,297,931	F119L	probably benign	Het
Asap1	A	G	15: 64,130,256	V402A	probably damaging	Het
Aspg	T	C	12: 112,124,821	V479A	possibly damaging	Het
B3galnt2	G	A	13: 13,994,485	V368M	probably benign	Het
Bcl3	T	C	7: 19,822,611	T23A	probably benign	Het
Bpifb5	A	G	2: 154,228,933	K215E	possibly damaging	Het
Coa4	T	A	7: 100,539,271	C64S	probably damaging	Het
Dcun1d4	T	C	5: 73,491,536		probably null	Het
Dnaaf5	T	G	5: 139,166,113	C506W	probably damaging	Het
Dock3	A	G	9: 107,023,732	Y345H	probably damaging	Het
Dscaml1	A	G	9: 45,710,326	N1024S	possibly damaging	Het
Dsp	T	C	13: 38,176,502		probably null	Het
Dsp	A	G	13: 38,195,449	T2057A	probably benign	Het
Dync1h1	T	G	12: 110,636,453	L2176R	probably damaging	Het
Eif5b	A	C	1: 38,051,637	D1192A	probably benign	Het
Epn2	A	T	11: 61,546,848		probably benign	Het
Exoc1	T	A	5: 76,545,348	N360K	probably benign	Het
Fam135b	A	T	15: 71,463,680	V555E	probably damaging	Het
Fam208a	T	A	14: 27,471,645	V934E	probably damaging	Het
Fmn1	A	T	2: 113,441,611	Q108L	unknown	Het
Gcc2	A	G	10: 58,256,901	T48A	probably benign	Het
Gm438	T	C	4: 144,777,762	D273G	probably damaging	Het
Gm6619	T	G	6: 131,490,391	I73S	possibly damaging	Het
Gm8267	T	A	14: 44,722,940	D116V	probably damaging	Het
Hapln3	T	A	7: 79,117,269	T341S	probably benign	Het
Lamb3	C	A	1: 193,332,166	D544E	possibly damaging	Het
Lhx5	T	A	5: 120,440,284	S390T	probably benign	Het
Lrrc63	A	G	14: 75,126,257	S145P	possibly damaging	Het
Lrriq1	T	C	10: 103,214,519	M791V	probably benign	Het
Lyg2	A	G	1: 37,911,137	Y37H	possibly damaging	Het
Nrbp1	T	A	5: 31,244,956	M172K	probably damaging	Het
Olfr1044	T	A	2: 86,171,010	D269V	probably damaging	Het
Olfr1261	A	G	2: 89,993,839	I149V	probably benign	Het
Olfr168	T	G	16: 19,530,900	S7R	probably benign	Het
Pcyt2	A	T	11: 120,611,383	Y308N	possibly damaging	Het
Peg10	C	CTCA	6: 4,756,453		probably benign	Het
Phf21b	A	G	15: 84,804,903	S141P	probably damaging	Het
Pigh	G	A	12: 79,089,550	P24S	probably benign	Het
Plekhg3	A	G	12: 76,576,485	D834G	probably damaging	Het
Pon1	A	G	6: 5,177,399	I170T	probably damaging	Het
Ptpn9	T	A	9: 57,027,433	Y160*	probably null	Het
Ptprj	T	C	2: 90,449,819	K1045R	possibly damaging	Het
Rilpl2	T	A	5: 124,463,788	H196L	probably benign	Het
Rnf112	C	T	11: 61,451,028	V317I	possibly damaging	Het
Rundc3a	G	T	11: 102,400,046		probably null	Het
Sgsm1	T	C	5: 113,274,321	Y489C	probably damaging	Het
Sis	G	A	3: 72,909,041	H1531Y	possibly damaging	Het
Slc26a9	A	G	1: 131,762,818	Y520C	probably damaging	Het
Smc5	A	G	19: 23,242,700	V467A	probably damaging	Het
Spata20	G	A	11: 94,484,041	A245V	probably benign	Het
Steap3	A	C	1: 120,241,518	F350V	probably benign	Het
Sucnr1	A	G	3: 60,086,696	Q215R	probably benign	Het
Supv3l1	G	A	10: 62,430,615	A594V	probably damaging	Het
Swt1	A	T	1: 151,411,064	F226I	probably benign	Het
Taar7f	A	G	10: 24,049,987	T160A	possibly damaging	Het
Tada2a	A	T	11: 84,126,986		probably null	Het
Taok3	C	A	5: 117,250,909	Q460K	probably damaging	Het
Twf2	A	G	9: 106,214,398	E268G	probably damaging	Het
Upf2	A	T	2: 6,018,932	I698F	unknown	Het
Vmn2r35	T	A	7: 7,817,014	N86Y	probably damaging	Het
Vmn2r84	T	C	10: 130,392,113	T85A	possibly damaging	Het
Vps13d	A	G	4: 145,105,856	S2833P		Het
Xrn1	T	C	9: 96,051,629	S1584P	probably benign	Het
Zfp354b	T	C	11: 50,922,397	Y567C	probably damaging	Het
Zfp52	A	T	17: 21,560,870	R327*	probably null	Het

Other mutations in Plekhg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00420:Plekhg5	APN	4	152102041	splice site	probably null
IGL01025:Plekhg5	APN	4	152108526	missense	probably damaging	1.00
IGL01062:Plekhg5	APN	4	152108496	missense	probably damaging	1.00
IGL01138:Plekhg5	APN	4	152106978	missense	probably damaging	1.00
IGL01301:Plekhg5	APN	4	152112553	missense	probably benign
IGL02372:Plekhg5	APN	4	152102080	missense	probably damaging	0.96
IGL02701:Plekhg5	APN	4	152103022	missense	probably damaging	1.00
ANU18:Plekhg5	UTSW	4	152112553	missense	probably benign
R0005:Plekhg5	UTSW	4	152112651	small deletion	probably benign
R0012:Plekhg5	UTSW	4	152104750	missense	probably benign	0.20
R0050:Plekhg5	UTSW	4	152108088	critical splice donor site	probably null
R0233:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0233:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0234:Plekhg5	UTSW	4	152112219	missense	probably damaging	1.00
R0346:Plekhg5	UTSW	4	152114253	missense	probably benign	0.08
R0555:Plekhg5	UTSW	4	152107469	nonsense	probably null
R0631:Plekhg5	UTSW	4	152112419	missense	possibly damaging	0.89
R0639:Plekhg5	UTSW	4	152114120	missense	probably benign	0.19
R1372:Plekhg5	UTSW	4	152104731	missense	probably damaging	0.99
R1563:Plekhg5	UTSW	4	152096809	missense	probably benign	0.33
R2870:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2870:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2871:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2871:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2872:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2872:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R2873:Plekhg5	UTSW	4	152107503	missense	probably benign	0.01
R3104:Plekhg5	UTSW	4	152112178	missense	probably damaging	1.00
R3106:Plekhg5	UTSW	4	152112178	missense	probably damaging	1.00
R3408:Plekhg5	UTSW	4	152108292	missense	probably damaging	1.00
R4289:Plekhg5	UTSW	4	152112427	missense	probably benign	0.05
R5157:Plekhg5	UTSW	4	152107865	splice site	probably benign
R5643:Plekhg5	UTSW	4	152104340	missense	probably benign	0.14
R5644:Plekhg5	UTSW	4	152104340	missense	probably benign	0.14
R5790:Plekhg5	UTSW	4	152113935	missense	probably benign
R6770:Plekhg5	UTSW	4	152103079	missense	probably benign
R7027:Plekhg5	UTSW	4	152113974	missense	probably benign	0.01
R7039:Plekhg5	UTSW	4	152107785	missense	possibly damaging	0.90
R7092:Plekhg5	UTSW	4	152114508	missense	probably damaging	1.00
R7309:Plekhg5	UTSW	4	152112528	missense	possibly damaging	0.50
R7319:Plekhg5	UTSW	4	152108428	missense	probably benign	0.13
R7543:Plekhg5	UTSW	4	152108034	missense	probably damaging	1.00
R7662:Plekhg5	UTSW	4	152104298	missense	probably damaging	1.00
R8271:Plekhg5	UTSW	4	152103007	missense	probably damaging	1.00
R8322:Plekhg5	UTSW	4	152104744	missense	possibly damaging	0.77
R8827:Plekhg5	UTSW	4	152107005	splice site	probably benign
R8987:Plekhg5	UTSW	4	152103915	intron	probably benign
R9024:Plekhg5	UTSW	4	152112661	missense	possibly damaging	0.71
R9428:Plekhg5	UTSW	4	152108323	missense	probably benign	0.00
R9515:Plekhg5	UTSW	4	152114369	missense	probably benign	0.09
R9672:Plekhg5	UTSW	4	152103084	missense	probably benign	0.03

Predicted Primers

PCR Primer
(F):5'- TAGATAATCTGGCTTTCTGACTCTC -3'
(R):5'- ATTTGGACTTGAGCAGGCGG -3'

Sequencing Primer
(F):5'- AATCTGGCTTTCTGACTCTCTTCTG -3'
(R):5'- CAGCTGGACAGGAGTGC -3'

Posted On

2019-10-07