Incidental Mutation 'R7439:Zfp52'
ID576857
Institutional Source Beutler Lab
Gene Symbol Zfp52
Ensembl Gene ENSMUSG00000051341
Gene Namezinc finger protein 52
SynonymsKRAB11, Zfp-52, zfec29, Zfp76
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R7439 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location21555046-21562066 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 21560870 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 327 (R327*)
Ref Sequence ENSEMBL: ENSMUSP00000078233 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079242]
Predicted Effect probably null
Transcript: ENSMUST00000079242
AA Change: R327*
SMART Domains Protein: ENSMUSP00000078233
Gene: ENSMUSG00000051341
AA Change: R327*

DomainStartEndE-ValueType
KRAB 13 73 3.79e-24 SMART
ZnF_C2H2 186 208 1.79e-2 SMART
ZnF_C2H2 214 236 5.07e0 SMART
ZnF_C2H2 242 264 2.29e1 SMART
ZnF_C2H2 270 292 2.36e-2 SMART
ZnF_C2H2 298 320 4.72e-2 SMART
ZnF_C2H2 326 348 1.77e1 SMART
ZnF_C2H2 382 404 1.12e-3 SMART
ZnF_C2H2 410 432 1.34e2 SMART
ZnF_C2H2 438 460 1.06e-4 SMART
ZnF_C2H2 466 488 6.99e-5 SMART
ZnF_C2H2 494 516 4.17e-3 SMART
ZnF_C2H2 522 544 5.5e-3 SMART
ZnF_C2H2 550 572 8.47e-4 SMART
ZnF_C2H2 578 600 1.01e-1 SMART
ZnF_C2H2 606 628 9.73e-4 SMART
ZnF_C2H2 634 656 4.17e-3 SMART
ZnF_C2H2 662 684 6.32e-3 SMART
ZnF_C2H2 690 712 1.69e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9530003J23Rik G A 10: 117,238,697 probably benign Het
Acacb T C 5: 114,195,642 V542A possibly damaging Het
Adprhl1 C T 8: 13,223,069 V1230I probably benign Het
Agpat1 T A 17: 34,610,909 Y77N probably damaging Het
Apc T A 18: 34,312,073 I674K probably damaging Het
Arpc5 T C 1: 152,771,436 S97P probably damaging Het
Arrdc5 A G 17: 56,297,931 F119L probably benign Het
Asap1 A G 15: 64,130,256 V402A probably damaging Het
Aspg T C 12: 112,124,821 V479A possibly damaging Het
B3galnt2 G A 13: 13,994,485 V368M probably benign Het
Bcl3 T C 7: 19,822,611 T23A probably benign Het
Bpifb5 A G 2: 154,228,933 K215E possibly damaging Het
Coa4 T A 7: 100,539,271 C64S probably damaging Het
Dcun1d4 T C 5: 73,491,536 probably null Het
Dnaaf5 T G 5: 139,166,113 C506W probably damaging Het
Dock3 A G 9: 107,023,732 Y345H probably damaging Het
Dscaml1 A G 9: 45,710,326 N1024S possibly damaging Het
Dsp T C 13: 38,176,502 probably null Het
Dsp A G 13: 38,195,449 T2057A probably benign Het
Dync1h1 T G 12: 110,636,453 L2176R probably damaging Het
Eif5b A C 1: 38,051,637 D1192A probably benign Het
Epn2 A T 11: 61,546,848 probably benign Het
Exoc1 T A 5: 76,545,348 N360K probably benign Het
Fam135b A T 15: 71,463,680 V555E probably damaging Het
Fam208a T A 14: 27,471,645 V934E probably damaging Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Gcc2 A G 10: 58,256,901 T48A probably benign Het
Gm438 T C 4: 144,777,762 D273G probably damaging Het
Gm6619 T G 6: 131,490,391 I73S possibly damaging Het
Gm8267 T A 14: 44,722,940 D116V probably damaging Het
Hapln3 T A 7: 79,117,269 T341S probably benign Het
Lamb3 C A 1: 193,332,166 D544E possibly damaging Het
Lhx5 T A 5: 120,440,284 S390T probably benign Het
Lrrc63 A G 14: 75,126,257 S145P possibly damaging Het
Lrriq1 T C 10: 103,214,519 M791V probably benign Het
Lyg2 A G 1: 37,911,137 Y37H possibly damaging Het
Nrbp1 T A 5: 31,244,956 M172K probably damaging Het
Olfr1044 T A 2: 86,171,010 D269V probably damaging Het
Olfr1261 A G 2: 89,993,839 I149V probably benign Het
Olfr168 T G 16: 19,530,900 S7R probably benign Het
Pcyt2 A T 11: 120,611,383 Y308N possibly damaging Het
Peg10 C CTCA 6: 4,756,453 probably benign Het
Phf21b A G 15: 84,804,903 S141P probably damaging Het
Pigh G A 12: 79,089,550 P24S probably benign Het
Plekhg3 A G 12: 76,576,485 D834G probably damaging Het
Plekhg5 T A 4: 152,113,935 V860D probably benign Het
Pon1 A G 6: 5,177,399 I170T probably damaging Het
Ptpn9 T A 9: 57,027,433 Y160* probably null Het
Ptprj T C 2: 90,449,819 K1045R possibly damaging Het
Rilpl2 T A 5: 124,463,788 H196L probably benign Het
Rnf112 C T 11: 61,451,028 V317I possibly damaging Het
Rundc3a G T 11: 102,400,046 probably null Het
Sgsm1 T C 5: 113,274,321 Y489C probably damaging Het
Sis G A 3: 72,909,041 H1531Y possibly damaging Het
Slc26a9 A G 1: 131,762,818 Y520C probably damaging Het
Smc5 A G 19: 23,242,700 V467A probably damaging Het
Spata20 G A 11: 94,484,041 A245V probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Sucnr1 A G 3: 60,086,696 Q215R probably benign Het
Supv3l1 G A 10: 62,430,615 A594V probably damaging Het
Swt1 A T 1: 151,411,064 F226I probably benign Het
Taar7f A G 10: 24,049,987 T160A possibly damaging Het
Tada2a A T 11: 84,126,986 probably null Het
Taok3 C A 5: 117,250,909 Q460K probably damaging Het
Twf2 A G 9: 106,214,398 E268G probably damaging Het
Upf2 A T 2: 6,018,932 I698F unknown Het
Vmn2r35 T A 7: 7,817,014 N86Y probably damaging Het
Vmn2r84 T C 10: 130,392,113 T85A possibly damaging Het
Vps13d A G 4: 145,105,856 S2833P Het
Xrn1 T C 9: 96,051,629 S1584P probably benign Het
Zfp354b T C 11: 50,922,397 Y567C probably damaging Het
Other mutations in Zfp52
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01752:Zfp52 APN 17 21560150 missense probably benign 0.12
PIT4449001:Zfp52 UTSW 17 21557216 missense probably damaging 1.00
R0270:Zfp52 UTSW 17 21561302 missense probably damaging 1.00
R0674:Zfp52 UTSW 17 21561846 missense probably damaging 1.00
R1224:Zfp52 UTSW 17 21555062 missense possibly damaging 0.70
R1248:Zfp52 UTSW 17 21560049 missense probably damaging 1.00
R1622:Zfp52 UTSW 17 21561571 missense probably benign 0.00
R1663:Zfp52 UTSW 17 21561822 missense possibly damaging 0.59
R1917:Zfp52 UTSW 17 21560164 missense probably benign
R4272:Zfp52 UTSW 17 21560197 nonsense probably null
R4273:Zfp52 UTSW 17 21560197 nonsense probably null
R4278:Zfp52 UTSW 17 21561870 missense probably benign
R4683:Zfp52 UTSW 17 21561507 missense probably benign 0.31
R4865:Zfp52 UTSW 17 21561243 missense probably damaging 1.00
R4964:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R4966:Zfp52 UTSW 17 21560403 missense probably benign 0.04
R5430:Zfp52 UTSW 17 21555067 missense probably benign 0.01
R5685:Zfp52 UTSW 17 21561751 missense probably benign 0.15
R6133:Zfp52 UTSW 17 21560471 missense probably damaging 1.00
R6882:Zfp52 UTSW 17 21555047 start codon destroyed probably null 1.00
R7083:Zfp52 UTSW 17 21560130 missense possibly damaging 0.86
R7456:Zfp52 UTSW 17 21561353 missense probably damaging 1.00
R7740:Zfp52 UTSW 17 21560990 missense probably damaging 1.00
R8196:Zfp52 UTSW 17 21561894 missense possibly damaging 0.45
Predicted Primers PCR Primer
(F):5'- ATGTGGGCACTGCAGGAAAT -3'
(R):5'- ACATTCTGTACATCTATACGGTCTCTT -3'

Sequencing Primer
(F):5'- TGGGCACTGCAGGAAATACTTC -3'
(R):5'- ATACGGTCTCTTTCCAGTATGAAC -3'
Posted On2019-10-07