Incidental Mutation 'R7658:Arhgap15'
ID591316
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene NameRho GTPase activating protein 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.381) question?
Stock #R7658 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location43748824-44395953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 44142268 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Proline at position 288 (H288P)
Ref Sequence ENSEMBL: ENSMUSP00000056461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
Predicted Effect probably benign
Transcript: ENSMUST00000055776
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: H288P

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112824
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: H288P

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 89,063,730 S72Y unknown Het
6430531B16Rik T C 7: 139,976,618 N152S probably benign Het
Abca8b T A 11: 109,935,717 K1568N probably benign Het
Adcy6 T A 15: 98,596,067 Y865F probably benign Het
Adgrf3 A T 5: 30,197,206 V608D probably benign Het
Agbl1 G T 7: 76,766,369 A965S unknown Het
Agbl3 C T 6: 34,832,508 P690L probably benign Het
Akap9 C G 5: 3,968,745 H1109D probably benign Het
Amt A C 9: 108,297,231 H65P probably damaging Het
Ankrd11 T A 8: 122,893,664 T1150S probably benign Het
Arhgap39 A T 15: 76,737,417 M328K probably benign Het
Arhgef12 T C 9: 42,992,536 K743R probably damaging Het
Atg2a T G 19: 6,251,263 V789G probably damaging Het
Ccdc54 T C 16: 50,590,481 T141A probably benign Het
Ccng2 C G 5: 93,273,343 S237R probably benign Het
Cdh5 T C 8: 104,129,401 probably null Het
Cdkl3 T C 11: 52,027,182 V404A not run Het
Chrm2 A T 6: 36,523,249 I14F probably benign Het
Cnbp T C 6: 87,845,276 K89E possibly damaging Het
Cntn6 T A 6: 104,650,483 D92E probably benign Het
Col15a1 T C 4: 47,245,591 F114S possibly damaging Het
Csrnp1 A G 9: 119,972,403 F530S probably benign Het
Dcun1d3 C T 7: 119,857,668 V274M probably damaging Het
Dph2 T A 4: 117,890,281 H302L possibly damaging Het
Fam162a A T 16: 36,046,400 Y118* probably null Het
Fam186a A G 15: 99,939,844 Y2840H unknown Het
Fto A G 8: 91,666,322 K466E probably benign Het
Gal T A 19: 3,413,309 Y41F probably damaging Het
Gigyf2 A T 1: 87,419,138 L620F unknown Het
Git2 C T 5: 114,766,489 R123H probably damaging Het
Glud1 A T 14: 34,311,157 E87V probably benign Het
Gm21190 T G 5: 15,527,925 E94A possibly damaging Het
Gm5592 T C 7: 41,288,710 V472A probably benign Het
Gpc5 T A 14: 115,428,208 N481K possibly damaging Het
Gpn2 A G 4: 133,591,376 E304G probably benign Het
Gsdmc2 T C 15: 63,825,054 T423A probably damaging Het
Gucy2e G A 11: 69,226,229 Q789* probably null Het
Gxylt2 T A 6: 100,783,143 V213E probably damaging Het
Ighv1-75 G A 12: 115,834,111 L64F possibly damaging Het
Il17re T C 6: 113,458,982 C30R probably benign Het
Il7 G T 3: 7,604,082 D31E probably benign Het
Ints4 T C 7: 97,529,253 Y687H possibly damaging Het
Kdelr1 T G 7: 45,882,977 V202G probably benign Het
Khnyn C A 14: 55,887,139 Y283* probably null Het
Klf11 T C 12: 24,653,671 V52A probably damaging Het
Klhl7 A G 5: 24,141,286 N310S probably benign Het
Krt27 A T 11: 99,349,486 L202Q possibly damaging Het
Lce1d A G 3: 92,686,047 C20R unknown Het
Lim2 A T 7: 43,433,630 I80F possibly damaging Het
Lrrk2 T A 15: 91,700,358 F326Y possibly damaging Het
Lyst A T 13: 13,730,476 Y3246F possibly damaging Het
Mafb T A 2: 160,366,435 H81L possibly damaging Het
Mfsd5 G A 15: 102,280,877 R228H probably benign Het
Mmp1b A T 9: 7,386,675 F150I possibly damaging Het
Mthfd1 T A 12: 76,270,435 L20Q probably damaging Het
Mxra8 A G 4: 155,842,963 T402A probably benign Het
Ndc80 A T 17: 71,508,663 L376M probably damaging Het
Nsd1 A T 13: 55,277,639 R1536S probably damaging Het
Nup210l C A 3: 90,211,993 H1874Q probably benign Het
Nyap1 T C 5: 137,732,974 H776R probably benign Het
Patj C A 4: 98,688,179 H1773Q probably damaging Het
Pax8 T A 2: 24,436,511 T280S probably benign Het
Pcdhb19 A G 18: 37,498,981 T610A probably damaging Het
Pde2a A G 7: 101,511,581 D919G possibly damaging Het
Pdk2 T A 11: 95,028,965 Y240F probably damaging Het
Peg3 A T 7: 6,709,610 I871N probably damaging Het
Pex1 A T 5: 3,596,244 probably benign Het
Pgm2l1 C T 7: 100,250,328 R50W probably damaging Het
Phkg1 T A 5: 129,865,923 K262N probably damaging Het
Pik3r4 A G 9: 105,644,511 E92G probably damaging Het
Prmt6 A T 3: 110,250,385 V196E possibly damaging Het
Ptprn2 T G 12: 116,722,119 M66R probably benign Het
Rai14 C T 15: 10,593,103 G152R probably damaging Het
Recql5 A T 11: 115,923,276 S348T probably damaging Het
Rfk T G 19: 17,398,682 probably null Het
Selenbp1 A T 3: 94,944,102 M389L probably benign Het
Sipa1l2 G A 8: 125,492,290 R103C probably benign Het
Slc10a6 T A 5: 103,629,190 S15C probably damaging Het
Slc12a2 G T 18: 57,932,524 V944L probably benign Het
Slc16a11 T A 11: 70,215,317 L127Q possibly damaging Het
St6gal1 A G 16: 23,356,228 Y272C probably damaging Het
Stab2 C A 10: 86,981,135 V133F probably benign Het
Stradb G A 1: 58,992,726 V266I probably damaging Het
Tmem150b A G 7: 4,720,759 W140R probably benign Het
Tnnt3 A T 7: 142,512,096 K157* probably null Het
Trove2 T C 1: 143,770,873 T45A probably damaging Het
Ttn T G 2: 76,723,769 K30863N probably damaging Het
Vldlr G A 19: 27,243,136 R592H probably benign Het
Vmn1r12 A T 6: 57,158,898 probably benign Het
Vmn2r63 A C 7: 42,925,269 S519R probably damaging Het
Zbtb22 G C 17: 33,918,497 E539Q probably damaging Het
Zbtb44 G A 9: 31,054,079 A262T probably benign Het
Zfp280d A T 9: 72,324,072 N455I probably damaging Het
Zfp287 T C 11: 62,725,263 N201D probably damaging Het
Zfp988 T C 4: 147,332,294 L395P probably damaging Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44243153 missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 44065045 missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43780755 missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 44063808 missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 44063837 missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44116662 missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44142350 critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43780736 missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44243131 missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44322767 missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 44063766 missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44116617 missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44116717 critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44142295 missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44243124 missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44386347 missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 44063786 missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43748890 start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44142341 missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43844813 critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44322755 missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R5202:Arhgap15 UTSW 2 44063857 missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43828760 missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44322727 missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44116677 missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 44063774 missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43780618 missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43780636 missense probably benign 0.01
R7735:Arhgap15 UTSW 2 44116630 missense probably damaging 1.00
R8734:Arhgap15 UTSW 2 44243118 missense probably damaging 1.00
R8743:Arhgap15 UTSW 2 43748864 start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTACCCGTGCCTGATCAAG -3'
(R):5'- TGGCTTCCCAGAGAAATCAAG -3'

Sequencing Primer
(F):5'- CCGGGAGATCAAGATTCTATTCC -3'
(R):5'- GCTTCCCAGAGAAATCAAGTGGTTC -3'
Posted On2019-11-12