Incidental Mutation 'R7658:Arhgap15'
ID 591316
Institutional Source Beutler Lab
Gene Symbol Arhgap15
Ensembl Gene ENSMUSG00000049744
Gene Name Rho GTPase activating protein 15
Synonyms 5830480G12Rik
MMRRC Submission 045703-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.497) question?
Stock # R7658 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 43638836-44285965 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 44032280 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Proline at position 288 (H288P)
Ref Sequence ENSEMBL: ENSMUSP00000056461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]
AlphaFold Q811M1
Predicted Effect probably benign
Transcript: ENSMUST00000055776
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: H288P

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 473 1.55e-63 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112822
SMART Domains Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

DomainStartEndE-ValueType
Blast:PH 88 108 5e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000112824
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: H288P

DomainStartEndE-ValueType
PH 88 199 1.24e-9 SMART
RhoGAP 298 469 1.16e-35 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 95 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110025L11Rik G T 16: 88,860,618 (GRCm39) S72Y unknown Het
Abca8b T A 11: 109,826,543 (GRCm39) K1568N probably benign Het
Adcy6 T A 15: 98,493,948 (GRCm39) Y865F probably benign Het
Adgrf3 A T 5: 30,402,204 (GRCm39) V608D probably benign Het
Agbl1 G T 7: 76,416,117 (GRCm39) A965S unknown Het
Agbl3 C T 6: 34,809,443 (GRCm39) P690L probably benign Het
Akap9 C G 5: 4,018,745 (GRCm39) H1109D probably benign Het
Amt A C 9: 108,174,430 (GRCm39) H65P probably damaging Het
Ankrd11 T A 8: 123,620,403 (GRCm39) T1150S probably benign Het
Arhgap39 A T 15: 76,621,617 (GRCm39) M328K probably benign Het
Arhgef12 T C 9: 42,903,832 (GRCm39) K743R probably damaging Het
Atg2a T G 19: 6,301,293 (GRCm39) V789G probably damaging Het
Ccdc54 T C 16: 50,410,844 (GRCm39) T141A probably benign Het
Ccng2 C G 5: 93,421,202 (GRCm39) S237R probably benign Het
Cdh5 T C 8: 104,856,033 (GRCm39) probably null Het
Cdkl3 T C 11: 51,918,009 (GRCm39) V404A not run Het
Chrm2 A T 6: 36,500,184 (GRCm39) I14F probably benign Het
Cnbp T C 6: 87,822,258 (GRCm39) K89E possibly damaging Het
Cntn6 T A 6: 104,627,444 (GRCm39) D92E probably benign Het
Col15a1 T C 4: 47,245,591 (GRCm39) F114S possibly damaging Het
Csrnp1 A G 9: 119,801,469 (GRCm39) F530S probably benign Het
Dcun1d3 C T 7: 119,456,891 (GRCm39) V274M probably damaging Het
Dph2 T A 4: 117,747,478 (GRCm39) H302L possibly damaging Het
Fam162a A T 16: 35,866,770 (GRCm39) Y118* probably null Het
Fam186a A G 15: 99,837,725 (GRCm39) Y2840H unknown Het
Fto A G 8: 92,392,950 (GRCm39) K466E probably benign Het
Gal T A 19: 3,463,309 (GRCm39) Y41F probably damaging Het
Gigyf2 A T 1: 87,346,860 (GRCm39) L620F unknown Het
Git2 C T 5: 114,904,550 (GRCm39) R123H probably damaging Het
Glud1 A T 14: 34,033,114 (GRCm39) E87V probably benign Het
Gm21190 T G 5: 15,732,923 (GRCm39) E94A possibly damaging Het
Gm5592 T C 7: 40,938,134 (GRCm39) V472A probably benign Het
Gpc5 T A 14: 115,665,620 (GRCm39) N481K possibly damaging Het
Gpn2 A G 4: 133,318,687 (GRCm39) E304G probably benign Het
Gsdmc2 T C 15: 63,696,903 (GRCm39) T423A probably damaging Het
Gucy2e G A 11: 69,117,055 (GRCm39) Q789* probably null Het
Gxylt2 T A 6: 100,760,104 (GRCm39) V213E probably damaging Het
Ighv1-75 G A 12: 115,797,731 (GRCm39) L64F possibly damaging Het
Il17re T C 6: 113,435,943 (GRCm39) C30R probably benign Het
Il7 G T 3: 7,669,142 (GRCm39) D31E probably benign Het
Ints4 T C 7: 97,178,460 (GRCm39) Y687H possibly damaging Het
Kdelr1 T G 7: 45,532,401 (GRCm39) V202G probably benign Het
Khnyn C A 14: 56,124,596 (GRCm39) Y283* probably null Het
Klf11 T C 12: 24,703,670 (GRCm39) V52A probably damaging Het
Klhl7 A G 5: 24,346,284 (GRCm39) N310S probably benign Het
Krt27 A T 11: 99,240,312 (GRCm39) L202Q possibly damaging Het
Lce1d A G 3: 92,593,354 (GRCm39) C20R unknown Het
Lim2 A T 7: 43,083,054 (GRCm39) I80F possibly damaging Het
Lrrk2 T A 15: 91,584,561 (GRCm39) F326Y possibly damaging Het
Lyst A T 13: 13,905,061 (GRCm39) Y3246F possibly damaging Het
Mafb T A 2: 160,208,355 (GRCm39) H81L possibly damaging Het
Mfsd5 G A 15: 102,189,312 (GRCm39) R228H probably benign Het
Mmp1b A T 9: 7,386,675 (GRCm39) F150I possibly damaging Het
Mthfd1 T A 12: 76,317,209 (GRCm39) L20Q probably damaging Het
Mxra8 A G 4: 155,927,420 (GRCm39) T402A probably benign Het
Ndc80 A T 17: 71,815,658 (GRCm39) L376M probably damaging Het
Nsd1 A T 13: 55,425,452 (GRCm39) R1536S probably damaging Het
Nup210l C A 3: 90,119,300 (GRCm39) H1874Q probably benign Het
Nyap1 T C 5: 137,731,236 (GRCm39) H776R probably benign Het
Patj C A 4: 98,576,416 (GRCm39) H1773Q probably damaging Het
Pax8 T A 2: 24,326,523 (GRCm39) T280S probably benign Het
Pcdhb19 A G 18: 37,632,034 (GRCm39) T610A probably damaging Het
Pde2a A G 7: 101,160,788 (GRCm39) D919G possibly damaging Het
Pdk2 T A 11: 94,919,791 (GRCm39) Y240F probably damaging Het
Peg3 A T 7: 6,712,609 (GRCm39) I871N probably damaging Het
Pex1 A T 5: 3,646,244 (GRCm39) probably benign Het
Pgm2l1 C T 7: 99,899,535 (GRCm39) R50W probably damaging Het
Phkg1 T A 5: 129,894,764 (GRCm39) K262N probably damaging Het
Pik3r4 A G 9: 105,521,710 (GRCm39) E92G probably damaging Het
Prmt6 A T 3: 110,157,701 (GRCm39) V196E possibly damaging Het
Ptprn2 T G 12: 116,685,739 (GRCm39) M66R probably benign Het
Rai14 C T 15: 10,593,189 (GRCm39) G152R probably damaging Het
Recql5 A T 11: 115,814,102 (GRCm39) S348T probably damaging Het
Rfk T G 19: 17,376,046 (GRCm39) probably null Het
Ro60 T C 1: 143,646,611 (GRCm39) T45A probably damaging Het
Selenbp1 A T 3: 94,851,413 (GRCm39) M389L probably benign Het
Sipa1l2 G A 8: 126,219,029 (GRCm39) R103C probably benign Het
Slc10a6 T A 5: 103,777,056 (GRCm39) S15C probably damaging Het
Slc12a2 G T 18: 58,065,596 (GRCm39) V944L probably benign Het
Slc16a11 T A 11: 70,106,143 (GRCm39) L127Q possibly damaging Het
Spef1l T C 7: 139,556,531 (GRCm39) N152S probably benign Het
St6gal1 A G 16: 23,174,978 (GRCm39) Y272C probably damaging Het
Stab2 C A 10: 86,816,999 (GRCm39) V133F probably benign Het
Stradb G A 1: 59,031,885 (GRCm39) V266I probably damaging Het
Tmem150b A G 7: 4,723,758 (GRCm39) W140R probably benign Het
Tnnt3 A T 7: 142,065,833 (GRCm39) K157* probably null Het
Ttn T G 2: 76,554,113 (GRCm39) K30863N probably damaging Het
Vldlr G A 19: 27,220,536 (GRCm39) R592H probably benign Het
Vmn1r12 A T 6: 57,135,883 (GRCm39) probably benign Het
Vmn2r63 A C 7: 42,574,693 (GRCm39) S519R probably damaging Het
Zbtb22 G C 17: 34,137,471 (GRCm39) E539Q probably damaging Het
Zbtb44 G A 9: 30,965,375 (GRCm39) A262T probably benign Het
Zfp280d A T 9: 72,231,354 (GRCm39) N455I probably damaging Het
Zfp287 T C 11: 62,616,089 (GRCm39) N201D probably damaging Het
Zfp988 T C 4: 147,416,751 (GRCm39) L395P probably damaging Het
Other mutations in Arhgap15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01533:Arhgap15 APN 2 44,133,165 (GRCm39) missense probably damaging 1.00
IGL01779:Arhgap15 APN 2 43,955,057 (GRCm39) missense possibly damaging 0.94
IGL02011:Arhgap15 APN 2 43,670,767 (GRCm39) missense probably damaging 1.00
IGL02506:Arhgap15 APN 2 43,953,820 (GRCm39) missense possibly damaging 0.73
IGL02659:Arhgap15 APN 2 43,953,849 (GRCm39) missense probably damaging 1.00
IGL02711:Arhgap15 APN 2 44,006,674 (GRCm39) missense possibly damaging 0.67
IGL02944:Arhgap15 APN 2 44,032,362 (GRCm39) critical splice donor site probably null
IGL02989:Arhgap15 APN 2 43,670,748 (GRCm39) missense probably damaging 1.00
PIT4468001:Arhgap15 UTSW 2 44,133,143 (GRCm39) missense probably damaging 1.00
R0140:Arhgap15 UTSW 2 44,212,779 (GRCm39) missense probably damaging 1.00
R0403:Arhgap15 UTSW 2 43,953,778 (GRCm39) missense probably damaging 0.98
R0557:Arhgap15 UTSW 2 44,006,629 (GRCm39) missense possibly damaging 0.60
R0616:Arhgap15 UTSW 2 44,006,729 (GRCm39) critical splice donor site probably null
R1122:Arhgap15 UTSW 2 44,032,307 (GRCm39) missense probably benign 0.43
R1958:Arhgap15 UTSW 2 44,133,136 (GRCm39) missense possibly damaging 0.67
R2258:Arhgap15 UTSW 2 44,276,359 (GRCm39) missense probably damaging 1.00
R2905:Arhgap15 UTSW 2 43,953,798 (GRCm39) missense probably damaging 0.97
R4788:Arhgap15 UTSW 2 43,638,902 (GRCm39) start codon destroyed probably null 0.02
R4793:Arhgap15 UTSW 2 44,032,353 (GRCm39) missense probably damaging 1.00
R5040:Arhgap15 UTSW 2 43,734,825 (GRCm39) critical splice donor site probably null
R5093:Arhgap15 UTSW 2 44,212,767 (GRCm39) missense probably damaging 1.00
R5114:Arhgap15 UTSW 2 43,670,630 (GRCm39) missense probably benign 0.03
R5202:Arhgap15 UTSW 2 43,953,869 (GRCm39) missense probably benign 0.22
R5446:Arhgap15 UTSW 2 43,718,772 (GRCm39) missense probably benign 0.00
R5661:Arhgap15 UTSW 2 44,212,739 (GRCm39) missense possibly damaging 0.54
R6747:Arhgap15 UTSW 2 44,006,689 (GRCm39) missense probably damaging 1.00
R7392:Arhgap15 UTSW 2 43,953,786 (GRCm39) missense possibly damaging 0.61
R7502:Arhgap15 UTSW 2 43,670,630 (GRCm39) missense probably benign 0.03
R7630:Arhgap15 UTSW 2 43,670,648 (GRCm39) missense probably benign 0.01
R7735:Arhgap15 UTSW 2 44,006,642 (GRCm39) missense probably damaging 1.00
R8734:Arhgap15 UTSW 2 44,133,130 (GRCm39) missense probably damaging 1.00
R8743:Arhgap15 UTSW 2 43,638,876 (GRCm39) start gained probably benign
Predicted Primers PCR Primer
(F):5'- GTTACCCGTGCCTGATCAAG -3'
(R):5'- TGGCTTCCCAGAGAAATCAAG -3'

Sequencing Primer
(F):5'- CCGGGAGATCAAGATTCTATTCC -3'
(R):5'- GCTTCCCAGAGAAATCAAGTGGTTC -3'
Posted On 2019-11-12