Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Arhgap15'

591316

Institutional Source

Beutler Lab

Gene Symbol

Arhgap15

Ensembl Gene

ENSMUSG00000049744

Gene Name

Rho GTPase activating protein 15

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.528) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

43748824-44395953 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to C at 44142268 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Histidine to Proline at position 288 (H288P)

Ref Sequence

ENSEMBL: ENSMUSP00000056461 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055776] [ENSMUST00000112822] [ENSMUST00000112824]

AlphaFold

Q811M1

Predicted Effect

probably benign
Transcript: ENSMUST00000055776
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000056461
Gene: ENSMUSG00000049744
AA Change: H288P

Domain	Start	End	E-Value	Type
PH	88	199	1.24e-9	SMART
RhoGAP	298	473	1.55e-63	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000112822

SMART Domains

Protein: ENSMUSP00000108441
Gene: ENSMUSG00000049744

Domain	Start	End	E-Value	Type
Blast:PH	88	108	5e-6	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000112824
AA Change: H288P

PolyPhen 2 Score 0.177 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000108443
Gene: ENSMUSG00000049744
AA Change: H288P

Domain	Start	End	E-Value	Type
PH	88	199	1.24e-9	SMART
RhoGAP	298	469	1.16e-35	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: The protein encoded by this gene is a RAC GTPase-activating protein that is regulated through its PH domain and by recruitment to the membrane. The protein accelerates hydrolysis of guanosine triphosphate to guanosine diphosphate to repress Rac activity. Knock-out of Arhgap15 function demonstrates that this gene is required to regulate multiple functions in macrophages and neutrophils. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for disruption of this gene display reduced leukocyte numbers and abnormally shaped macrophage. Chemotactic responses of macrophage are normal while neutrophile chemoattraction and bacterial pagocytosis are increased. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Arhgap15

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01533:Arhgap15	APN	2	44243153	missense	probably damaging	1.00
IGL01779:Arhgap15	APN	2	44065045	missense	possibly damaging	0.94
IGL02011:Arhgap15	APN	2	43780755	missense	probably damaging	1.00
IGL02506:Arhgap15	APN	2	44063808	missense	possibly damaging	0.73
IGL02659:Arhgap15	APN	2	44063837	missense	probably damaging	1.00
IGL02711:Arhgap15	APN	2	44116662	missense	possibly damaging	0.67
IGL02944:Arhgap15	APN	2	44142350	critical splice donor site	probably null
IGL02989:Arhgap15	APN	2	43780736	missense	probably damaging	1.00
PIT4468001:Arhgap15	UTSW	2	44243131	missense	probably damaging	1.00
R0140:Arhgap15	UTSW	2	44322767	missense	probably damaging	1.00
R0403:Arhgap15	UTSW	2	44063766	missense	probably damaging	0.98
R0557:Arhgap15	UTSW	2	44116617	missense	possibly damaging	0.60
R0616:Arhgap15	UTSW	2	44116717	critical splice donor site	probably null
R1122:Arhgap15	UTSW	2	44142295	missense	probably benign	0.43
R1958:Arhgap15	UTSW	2	44243124	missense	possibly damaging	0.67
R2258:Arhgap15	UTSW	2	44386347	missense	probably damaging	1.00
R2905:Arhgap15	UTSW	2	44063786	missense	probably damaging	0.97
R4788:Arhgap15	UTSW	2	43748890	start codon destroyed	probably null	0.02
R4793:Arhgap15	UTSW	2	44142341	missense	probably damaging	1.00
R5040:Arhgap15	UTSW	2	43844813	critical splice donor site	probably null
R5093:Arhgap15	UTSW	2	44322755	missense	probably damaging	1.00
R5114:Arhgap15	UTSW	2	43780618	missense	probably benign	0.03
R5202:Arhgap15	UTSW	2	44063857	missense	probably benign	0.22
R5446:Arhgap15	UTSW	2	43828760	missense	probably benign	0.00
R5661:Arhgap15	UTSW	2	44322727	missense	possibly damaging	0.54
R6747:Arhgap15	UTSW	2	44116677	missense	probably damaging	1.00
R7392:Arhgap15	UTSW	2	44063774	missense	possibly damaging	0.61
R7502:Arhgap15	UTSW	2	43780618	missense	probably benign	0.03
R7630:Arhgap15	UTSW	2	43780636	missense	probably benign	0.01
R7735:Arhgap15	UTSW	2	44116630	missense	probably damaging	1.00
R8734:Arhgap15	UTSW	2	44243118	missense	probably damaging	1.00
R8743:Arhgap15	UTSW	2	43748864	start gained	probably benign

Predicted Primers

PCR Primer
(F):5'- GTTACCCGTGCCTGATCAAG -3'
(R):5'- TGGCTTCCCAGAGAAATCAAG -3'

Sequencing Primer
(F):5'- CCGGGAGATCAAGATTCTATTCC -3'
(R):5'- GCTTCCCAGAGAAATCAAGTGGTTC -3'

Posted On

2019-11-12