Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Arhgef12'

591366

Institutional Source

Beutler Lab

Gene Symbol

Arhgef12

Ensembl Gene

ENSMUSG00000059495

Gene Name

Rho guanine nucleotide exchange factor (GEF) 12

Synonyms

LARG, 2310014B11Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

42963842-43107239 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 42992536 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Arginine at position 743 (K743R)

Ref Sequence

ENSEMBL: ENSMUSP00000126598 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000072767] [ENSMUST00000165665]

AlphaFold

Q8R4H2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000072767
AA Change: K742R

PolyPhen 2 Score 0.533 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000072547
Gene: ENSMUSG00000059495
AA Change: K742R

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	368	558	8.6e-87	PFAM
low complexity region	583	596	N/A	INTRINSIC
low complexity region	663	676	N/A	INTRINSIC
low complexity region	721	733	N/A	INTRINSIC
RhoGEF	791	976	6.35e-66	SMART
PH	1020	1134	6.26e-6	SMART
low complexity region	1256	1269	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000165665
AA Change: K743R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000126598
Gene: ENSMUSG00000059495
AA Change: K743R

Domain	Start	End	E-Value	Type
low complexity region	49	64	N/A	INTRINSIC
PDZ	80	148	1.64e-19	SMART
coiled coil region	196	259	N/A	INTRINSIC
low complexity region	293	313	N/A	INTRINSIC
Pfam:RGS-like	369	559	1.6e-88	PFAM
low complexity region	584	597	N/A	INTRINSIC
low complexity region	664	677	N/A	INTRINSIC
low complexity region	722	734	N/A	INTRINSIC
RhoGEF	792	977	6.35e-66	SMART
PH	1021	1135	6.26e-6	SMART
low complexity region	1257	1270	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases play a fundamental role in numerous cellular processes that are initiated by extracellular stimuli working through G protein-coupled receptors. The encoded protein may form a complex with G proteins and stimulate Rho-dependent signals. This protein has been observed to form a myeloid/lymphoid fusion partner in acute myeloid leukemia. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to certain vasoconstrictors and resistance to salt-induced hypertension. Mice homozygous for a different knock-out allele exhibit partial prenatal lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vldlr	G	A	19: 27,243,136	R592H	probably benign	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Arhgef12

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00923:Arhgef12	APN	9	43020624	missense	probably damaging	1.00
IGL00942:Arhgef12	APN	9	42982000	missense	probably damaging	1.00
IGL01529:Arhgef12	APN	9	42990055	missense	probably damaging	1.00
IGL01845:Arhgef12	APN	9	43022841	missense	possibly damaging	0.56
IGL02039:Arhgef12	APN	9	42972267	missense	probably benign
IGL02135:Arhgef12	APN	9	42972165	missense	possibly damaging	0.68
IGL02272:Arhgef12	APN	9	43001452	missense	probably damaging	1.00
IGL02498:Arhgef12	APN	9	42982043	missense	probably benign	0.19
IGL02507:Arhgef12	APN	9	42992563	missense	probably damaging	1.00
IGL02574:Arhgef12	APN	9	43005623	missense	probably damaging	0.99
IGL02586:Arhgef12	APN	9	43005904	nonsense	probably null
IGL02803:Arhgef12	APN	9	42972028	missense	possibly damaging	0.48
IGL02892:Arhgef12	APN	9	43000972	missense	possibly damaging	0.79
IGL02937:Arhgef12	APN	9	43015920	missense	probably damaging	0.97
IGL02992:Arhgef12	APN	9	42999077	missense	probably damaging	1.00
IGL03028:Arhgef12	APN	9	43026228	missense	possibly damaging	0.84
IGL03146:Arhgef12	APN	9	42974570	missense	possibly damaging	0.90
IGL03193:Arhgef12	APN	9	42992533	splice site	probably benign
IGL03398:Arhgef12	APN	9	42978226	missense	probably damaging	1.00
R0019:Arhgef12	UTSW	9	42978233	missense	probably damaging	1.00
R0143:Arhgef12	UTSW	9	43005594	missense	probably damaging	1.00
R0211:Arhgef12	UTSW	9	42972004	missense	probably damaging	0.97
R0330:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R0364:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0426:Arhgef12	UTSW	9	42970990	splice site	probably null
R0658:Arhgef12	UTSW	9	42981985	missense	probably damaging	1.00
R0686:Arhgef12	UTSW	9	42993028	missense	probably benign	0.02
R0693:Arhgef12	UTSW	9	43018401	missense	probably damaging	0.99
R0990:Arhgef12	UTSW	9	42972381	missense	probably benign	0.00
R1147:Arhgef12	UTSW	9	43044256	unclassified	probably benign
R1395:Arhgef12	UTSW	9	43005870	missense	probably damaging	1.00
R1419:Arhgef12	UTSW	9	43027220	missense	probably damaging	1.00
R1451:Arhgef12	UTSW	9	42992578	splice site	probably benign
R1458:Arhgef12	UTSW	9	42988998	missense	probably damaging	0.98
R1654:Arhgef12	UTSW	9	42997660	missense	possibly damaging	0.83
R1722:Arhgef12	UTSW	9	43020717	makesense	probably null
R1773:Arhgef12	UTSW	9	43005542	critical splice donor site	probably null
R1895:Arhgef12	UTSW	9	43005856	missense	probably damaging	1.00
R2109:Arhgef12	UTSW	9	42979472	missense	possibly damaging	0.75
R2215:Arhgef12	UTSW	9	43005871	missense	probably damaging	1.00
R2421:Arhgef12	UTSW	9	43001006	missense	probably damaging	1.00
R3967:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3968:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R3969:Arhgef12	UTSW	9	43005551	missense	probably damaging	1.00
R4077:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4079:Arhgef12	UTSW	9	42975292	missense	probably damaging	0.99
R4111:Arhgef12	UTSW	9	42972274	missense	probably damaging	1.00
R4302:Arhgef12	UTSW	9	43018349	nonsense	probably null
R4327:Arhgef12	UTSW	9	42975229	nonsense	probably null
R4462:Arhgef12	UTSW	9	42981982	missense	probably damaging	1.00
R4583:Arhgef12	UTSW	9	42977662	missense	probably damaging	1.00
R4603:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R4650:Arhgef12	UTSW	9	42981970	missense	probably damaging	1.00
R4741:Arhgef12	UTSW	9	42972153	missense	possibly damaging	0.54
R4823:Arhgef12	UTSW	9	43020696	missense	probably benign
R4840:Arhgef12	UTSW	9	42975068	missense	probably benign	0.04
R4912:Arhgef12	UTSW	9	42993065	nonsense	probably null
R5176:Arhgef12	UTSW	9	43020686	missense	probably damaging	0.97
R5426:Arhgef12	UTSW	9	42986584	missense	probably damaging	1.00
R5579:Arhgef12	UTSW	9	43010193	missense	probably benign	0.27
R5838:Arhgef12	UTSW	9	43005608	missense	probably damaging	1.00
R6230:Arhgef12	UTSW	9	42988965	missense	probably benign	0.04
R6741:Arhgef12	UTSW	9	42972207	missense	probably benign	0.05
R6959:Arhgef12	UTSW	9	43015953	missense	probably benign
R7252:Arhgef12	UTSW	9	43015909	missense	probably benign	0.17
R7470:Arhgef12	UTSW	9	43040552	missense	probably damaging	1.00
R7724:Arhgef12	UTSW	9	43027271	missense	probably damaging	1.00
R7980:Arhgef12	UTSW	9	42971299	nonsense	probably null
R8074:Arhgef12	UTSW	9	42971103	nonsense	probably null
R8155:Arhgef12	UTSW	9	43042662	missense	probably damaging	1.00
R8270:Arhgef12	UTSW	9	42971058	missense	probably benign
R8407:Arhgef12	UTSW	9	43026179	critical splice donor site	probably null
R8527:Arhgef12	UTSW	9	42997648	missense	possibly damaging	0.95
R9127:Arhgef12	UTSW	9	42974574	missense	possibly damaging	0.94
RF020:Arhgef12	UTSW	9	42989989	missense	possibly damaging	0.75
Z1176:Arhgef12	UTSW	9	42971072	missense	probably benign	0.00
Z1186:Arhgef12	UTSW	9	43000015	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCATCTGATTCAGCACTGAG -3'
(R):5'- AGAGCTTTGTGCATTGCTTAC -3'

Sequencing Primer
(F):5'- TGAGCCCAAGACTCCTCTCCTAG -3'
(R):5'- CTGGAACTTGCTCTGTAGACCAG -3'

Posted On

2019-11-12