Mutagenetix > Incidental Mutations

Incidental Mutation 'R7658:Vldlr'

591407

Institutional Source

Beutler Lab

Gene Symbol

Vldlr

Ensembl Gene

ENSMUSG00000024924

Gene Name

very low density lipoprotein receptor

Synonyms

AA408956, AI451093, AW047288, VLDL receptor

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.265) question?

Stock #

R7658 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

27216484-27254231 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 27243136 bp

Zygosity

Heterozygous

Amino Acid Change

Arginine to Histidine at position 592 (R592H)

Ref Sequence

ENSEMBL: ENSMUSP00000127329 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025866] [ENSMUST00000047645] [ENSMUST00000165761] [ENSMUST00000167487] [ENSMUST00000172302]

Predicted Effect

probably benign
Transcript: ENSMUST00000025866

SMART Domains

Protein: ENSMUSP00000025866
Gene: ENSMUSG00000024924

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
Blast:LY	461	495	4e-15	BLAST

Predicted Effect

possibly damaging
Transcript: ENSMUST00000047645
AA Change: R551H

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000049145
Gene: ENSMUSG00000024924
AA Change: R551H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	1.25e-14	SMART
LDLa	112	149	7.15e-15	SMART
LDLa	151	190	1.23e-13	SMART
LDLa	197	234	1.1e-15	SMART
LDLa	236	273	1.13e-12	SMART
LDLa	276	316	3.86e-11	SMART
EGF_CA	315	354	1e-5	SMART
EGF_CA	355	394	6.1e-10	SMART
LY	420	462	2.16e-1	SMART
LY	464	506	9.54e-12	SMART
LY	507	550	2.22e-12	SMART
LY	551	593	1.66e-11	SMART
LY	594	637	5.97e-4	SMART
EGF	664	709	2.16e-1	SMART
transmembrane domain	728	750	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000165761
AA Change: R219H

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130382
Gene: ENSMUSG00000024924
AA Change: R219H

Domain	Start	End	E-Value	Type
LDLa	1	26	1.58e0	SMART
EGF	28	64	4e-5	SMART
LY	88	130	2.16e-1	SMART
LY	132	174	9.54e-12	SMART
LY	175	218	2.22e-12	SMART
LY	219	258	3.25e-5	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000167487
AA Change: R592H

PolyPhen 2 Score 0.331 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000127329
Gene: ENSMUSG00000024924
AA Change: R592H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	797	819	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000172302
AA Change: R592H

PolyPhen 2 Score 0.607 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000126730
Gene: ENSMUSG00000024924
AA Change: R592H

Domain	Start	End	E-Value	Type
signal peptide	1	23	N/A	INTRINSIC
EGF_like	32	68	7.38e1	SMART
LDLa	32	69	1.69e-16	SMART
LDLa	71	110	5.81e-15	SMART
LDLa	112	151	1.96e-12	SMART
LDLa	153	190	7.15e-15	SMART
LDLa	192	231	1.23e-13	SMART
LDLa	238	275	1.1e-15	SMART
LDLa	277	314	1.13e-12	SMART
LDLa	317	357	3.86e-11	SMART
EGF_CA	356	395	1e-5	SMART
EGF_CA	396	435	6.1e-10	SMART
LY	461	503	2.16e-1	SMART
LY	505	547	9.54e-12	SMART
LY	548	591	2.22e-12	SMART
LY	592	634	1.66e-11	SMART
LY	635	678	5.97e-4	SMART
EGF	705	750	2.16e-1	SMART
transmembrane domain	769	791	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The low density lipoprotein receptor (LDLR) gene family consists of cell surface proteins involved in receptor-mediated endocytosis of specific ligands. This gene encodes a lipoprotein receptor that is a member of the LDLR family and plays important roles in VLDL-triglyceride metabolism and the reelin signaling pathway. Mutations in this gene cause VLDLR-associated cerebellar hypoplasia. Alternative splicing generates multiple transcript variants encoding distinct isoforms for this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous null mutants exhibit modest reductions in body weight and adiposity. In behavioral tests, mutants display deficits in contextual fear conditioning and long term potentiation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 95 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1110025L11Rik	G	T	16: 89,063,730	S72Y	unknown	Het
6430531B16Rik	T	C	7: 139,976,618	N152S	probably benign	Het
Abca8b	T	A	11: 109,935,717	K1568N	probably benign	Het
Adcy6	T	A	15: 98,596,067	Y865F	probably benign	Het
Adgrf3	A	T	5: 30,197,206	V608D	probably benign	Het
Agbl1	G	T	7: 76,766,369	A965S	unknown	Het
Agbl3	C	T	6: 34,832,508	P690L	probably benign	Het
Akap9	C	G	5: 3,968,745	H1109D	probably benign	Het
Amt	A	C	9: 108,297,231	H65P	probably damaging	Het
Ankrd11	T	A	8: 122,893,664	T1150S	probably benign	Het
Arhgap15	A	C	2: 44,142,268	H288P	probably benign	Het
Arhgap39	A	T	15: 76,737,417	M328K	probably benign	Het
Arhgef12	T	C	9: 42,992,536	K743R	probably damaging	Het
Atg2a	T	G	19: 6,251,263	V789G	probably damaging	Het
Ccdc54	T	C	16: 50,590,481	T141A	probably benign	Het
Ccng2	C	G	5: 93,273,343	S237R	probably benign	Het
Cdh5	T	C	8: 104,129,401		probably null	Het
Cdkl3	T	C	11: 52,027,182	V404A	not run	Het
Chrm2	A	T	6: 36,523,249	I14F	probably benign	Het
Cnbp	T	C	6: 87,845,276	K89E	possibly damaging	Het
Cntn6	T	A	6: 104,650,483	D92E	probably benign	Het
Col15a1	T	C	4: 47,245,591	F114S	possibly damaging	Het
Csrnp1	A	G	9: 119,972,403	F530S	probably benign	Het
Dcun1d3	C	T	7: 119,857,668	V274M	probably damaging	Het
Dph2	T	A	4: 117,890,281	H302L	possibly damaging	Het
Fam162a	A	T	16: 36,046,400	Y118*	probably null	Het
Fam186a	A	G	15: 99,939,844	Y2840H	unknown	Het
Fto	A	G	8: 91,666,322	K466E	probably benign	Het
Gal	T	A	19: 3,413,309	Y41F	probably damaging	Het
Gigyf2	A	T	1: 87,419,138	L620F	unknown	Het
Git2	C	T	5: 114,766,489	R123H	probably damaging	Het
Glud1	A	T	14: 34,311,157	E87V	probably benign	Het
Gm21190	T	G	5: 15,527,925	E94A	possibly damaging	Het
Gm5592	T	C	7: 41,288,710	V472A	probably benign	Het
Gpc5	T	A	14: 115,428,208	N481K	possibly damaging	Het
Gpn2	A	G	4: 133,591,376	E304G	probably benign	Het
Gsdmc2	T	C	15: 63,825,054	T423A	probably damaging	Het
Gucy2e	G	A	11: 69,226,229	Q789*	probably null	Het
Gxylt2	T	A	6: 100,783,143	V213E	probably damaging	Het
Ighv1-75	G	A	12: 115,834,111	L64F	possibly damaging	Het
Il17re	T	C	6: 113,458,982	C30R	probably benign	Het
Il7	G	T	3: 7,604,082	D31E	probably benign	Het
Ints4	T	C	7: 97,529,253	Y687H	possibly damaging	Het
Kdelr1	T	G	7: 45,882,977	V202G	probably benign	Het
Khnyn	C	A	14: 55,887,139	Y283*	probably null	Het
Klf11	T	C	12: 24,653,671	V52A	probably damaging	Het
Klhl7	A	G	5: 24,141,286	N310S	probably benign	Het
Krt27	A	T	11: 99,349,486	L202Q	possibly damaging	Het
Lce1d	A	G	3: 92,686,047	C20R	unknown	Het
Lim2	A	T	7: 43,433,630	I80F	possibly damaging	Het
Lrrk2	T	A	15: 91,700,358	F326Y	possibly damaging	Het
Lyst	A	T	13: 13,730,476	Y3246F	possibly damaging	Het
Mafb	T	A	2: 160,366,435	H81L	possibly damaging	Het
Mfsd5	G	A	15: 102,280,877	R228H	probably benign	Het
Mmp1b	A	T	9: 7,386,675	F150I	possibly damaging	Het
Mthfd1	T	A	12: 76,270,435	L20Q	probably damaging	Het
Mxra8	A	G	4: 155,842,963	T402A	probably benign	Het
Ndc80	A	T	17: 71,508,663	L376M	probably damaging	Het
Nsd1	A	T	13: 55,277,639	R1536S	probably damaging	Het
Nup210l	C	A	3: 90,211,993	H1874Q	probably benign	Het
Nyap1	T	C	5: 137,732,974	H776R	probably benign	Het
Patj	C	A	4: 98,688,179	H1773Q	probably damaging	Het
Pax8	T	A	2: 24,436,511	T280S	probably benign	Het
Pcdhb19	A	G	18: 37,498,981	T610A	probably damaging	Het
Pde2a	A	G	7: 101,511,581	D919G	possibly damaging	Het
Pdk2	T	A	11: 95,028,965	Y240F	probably damaging	Het
Peg3	A	T	7: 6,709,610	I871N	probably damaging	Het
Pex1	A	T	5: 3,596,244		probably benign	Het
Pgm2l1	C	T	7: 100,250,328	R50W	probably damaging	Het
Phkg1	T	A	5: 129,865,923	K262N	probably damaging	Het
Pik3r4	A	G	9: 105,644,511	E92G	probably damaging	Het
Prmt6	A	T	3: 110,250,385	V196E	possibly damaging	Het
Ptprn2	T	G	12: 116,722,119	M66R	probably benign	Het
Rai14	C	T	15: 10,593,103	G152R	probably damaging	Het
Recql5	A	T	11: 115,923,276	S348T	probably damaging	Het
Rfk	T	G	19: 17,398,682		probably null	Het
Selenbp1	A	T	3: 94,944,102	M389L	probably benign	Het
Sipa1l2	G	A	8: 125,492,290	R103C	probably benign	Het
Slc10a6	T	A	5: 103,629,190	S15C	probably damaging	Het
Slc12a2	G	T	18: 57,932,524	V944L	probably benign	Het
Slc16a11	T	A	11: 70,215,317	L127Q	possibly damaging	Het
St6gal1	A	G	16: 23,356,228	Y272C	probably damaging	Het
Stab2	C	A	10: 86,981,135	V133F	probably benign	Het
Stradb	G	A	1: 58,992,726	V266I	probably damaging	Het
Tmem150b	A	G	7: 4,720,759	W140R	probably benign	Het
Tnnt3	A	T	7: 142,512,096	K157*	probably null	Het
Trove2	T	C	1: 143,770,873	T45A	probably damaging	Het
Ttn	T	G	2: 76,723,769	K30863N	probably damaging	Het
Vmn1r12	A	T	6: 57,158,898		probably benign	Het
Vmn2r63	A	C	7: 42,925,269	S519R	probably damaging	Het
Zbtb22	G	C	17: 33,918,497	E539Q	probably damaging	Het
Zbtb44	G	A	9: 31,054,079	A262T	probably benign	Het
Zfp280d	A	T	9: 72,324,072	N455I	probably damaging	Het
Zfp287	T	C	11: 62,725,263	N201D	probably damaging	Het
Zfp988	T	C	4: 147,332,294	L395P	probably damaging	Het

Other mutations in Vldlr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01346:Vldlr	APN	19	27239681	missense	possibly damaging	0.93
IGL01575:Vldlr	APN	19	27246631	missense	probably benign
IGL01626:Vldlr	APN	19	27243773	missense	probably damaging	1.00
IGL02213:Vldlr	APN	19	27241326	missense	probably benign	0.09
IGL02365:Vldlr	APN	19	27245625	missense	probably damaging	1.00
IGL02488:Vldlr	APN	19	27238275	missense	probably damaging	1.00
IGL02708:Vldlr	APN	19	27238085	missense	possibly damaging	0.92
IGL02947:Vldlr	APN	19	27239720	missense	probably benign	0.03
disturbed	UTSW	19	27238804	nonsense	probably null
r26	UTSW	19	27245654	missense	probably damaging	0.99
spotty	UTSW	19	27238792	missense	probably damaging	1.00
PIT4142001:Vldlr	UTSW	19	27234869	missense	probably benign	0.05
R0195:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R0288:Vldlr	UTSW	19	27240651	splice site	probably benign
R0536:Vldlr	UTSW	19	27239964	missense	probably damaging	1.00
R0537:Vldlr	UTSW	19	27247918	missense	probably damaging	1.00
R0542:Vldlr	UTSW	19	27236255	missense	probably benign	0.01
R0594:Vldlr	UTSW	19	27234819	missense	probably damaging	1.00
R0624:Vldlr	UTSW	19	27238263	missense	possibly damaging	0.91
R0726:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R1017:Vldlr	UTSW	19	27241333	missense	probably damaging	1.00
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1148:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1443:Vldlr	UTSW	19	27239721	missense	possibly damaging	0.91
R1493:Vldlr	UTSW	19	27241291	missense	probably benign	0.01
R1520:Vldlr	UTSW	19	27240543	missense	probably damaging	0.99
R1520:Vldlr	UTSW	19	27247066	missense	possibly damaging	0.96
R1657:Vldlr	UTSW	19	27245670	missense	probably benign	0.00
R1901:Vldlr	UTSW	19	27241309	missense	probably damaging	1.00
R2047:Vldlr	UTSW	19	27234838	missense	probably damaging	1.00
R2258:Vldlr	UTSW	19	27238386	missense	probably damaging	1.00
R2273:Vldlr	UTSW	19	27248015	missense	probably damaging	1.00
R2423:Vldlr	UTSW	19	27236288	missense	possibly damaging	0.49
R3196:Vldlr	UTSW	19	27243154	missense	probably damaging	0.98
R3752:Vldlr	UTSW	19	27238331	missense	probably damaging	1.00
R3801:Vldlr	UTSW	19	27217621	missense	probably damaging	0.99
R3835:Vldlr	UTSW	19	27234814	missense	probably damaging	1.00
R4027:Vldlr	UTSW	19	27238313	missense	probably benign
R4301:Vldlr	UTSW	19	27238402	missense	possibly damaging	0.80
R4470:Vldlr	UTSW	19	27234819	missense	probably damaging	0.96
R4541:Vldlr	UTSW	19	27238792	missense	probably damaging	1.00
R4765:Vldlr	UTSW	19	27240547	missense	probably damaging	1.00
R4771:Vldlr	UTSW	19	27239890	missense	probably damaging	0.97
R4795:Vldlr	UTSW	19	27238852	splice site	probably null
R4839:Vldlr	UTSW	19	27238065	missense	probably damaging	1.00
R5074:Vldlr	UTSW	19	27238277	missense	probably damaging	1.00
R5134:Vldlr	UTSW	19	27238812	nonsense	probably null
R5281:Vldlr	UTSW	19	27244231	missense	probably benign	0.44
R5466:Vldlr	UTSW	19	27239843	critical splice acceptor site	probably null
R5514:Vldlr	UTSW	19	27244224	missense	probably damaging	0.97
R5886:Vldlr	UTSW	19	27243771	missense	probably benign	0.03
R5889:Vldlr	UTSW	19	27239664	missense	probably damaging	1.00
R6110:Vldlr	UTSW	19	27238077	missense	possibly damaging	0.92
R6343:Vldlr	UTSW	19	27245649	missense	probably damaging	0.99
R6833:Vldlr	UTSW	19	27240574	missense	probably damaging	1.00
R6838:Vldlr	UTSW	19	27247970	missense	probably damaging	1.00
R7169:Vldlr	UTSW	19	27244328	missense	probably benign
R7197:Vldlr	UTSW	19	27234841	missense	probably benign	0.36
R7304:Vldlr	UTSW	19	27238604	missense	possibly damaging	0.93
R7403:Vldlr	UTSW	19	27236274	nonsense	probably null
R7754:Vldlr	UTSW	19	27217615	start codon destroyed	probably benign	0.01
R8105:Vldlr	UTSW	19	27238804	nonsense	probably null
R8377:Vldlr	UTSW	19	27234858	missense	probably damaging	1.00
R8529:Vldlr	UTSW	19	27230256	missense	probably benign	0.03
R8777:Vldlr	UTSW	19	27240546	missense	probably benign	0.00
R8777-TAIL:Vldlr	UTSW	19	27240546	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- GCTTAAGGGTTTCCTGATCATTC -3'
(R):5'- TGGATGACAAGCCAGTGATC -3'

Sequencing Primer
(F):5'- AGGGTTTCCTGATCATTCTTTAAGC -3'
(R):5'- CAGTGATCTGGCACCCATAATTTG -3'

Posted On

2019-11-12