Incidental Mutation 'R7687:Tcp10a'
ID593178
Institutional Source Beutler Lab
Gene Symbol Tcp10a
Ensembl Gene ENSMUSG00000071322
Gene Namet-complex protein 10a
SynonymsD17Leh66A, D17Leh66aa, T66A-a, Gm10326, Tcp-10a
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7687 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location7324646-7345974 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7345108 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 433 (V433D)
Ref Sequence ENSEMBL: ENSMUSP00000093394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095726] [ENSMUST00000128533] [ENSMUST00000129709] [ENSMUST00000138222] [ENSMUST00000140192]
Predicted Effect probably damaging
Transcript: ENSMUST00000095726
AA Change: V433D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093394
Gene: ENSMUSG00000071322
AA Change: V433D

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 263 437 1.3e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128533
AA Change: V433D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114351
Gene: ENSMUSG00000071322
AA Change: V433D

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 438 1.1e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000129709
AA Change: V433D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114830
Gene: ENSMUSG00000071322
AA Change: V433D

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 438 1.1e-90 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138222
AA Change: V415D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115431
Gene: ENSMUSG00000071322
AA Change: V415D

DomainStartEndE-ValueType
coiled coil region 36 76 N/A INTRINSIC
low complexity region 223 238 N/A INTRINSIC
Pfam:Tcp10_C 245 419 6.7e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140192
SMART Domains Protein: ENSMUSP00000117557
Gene: ENSMUSG00000071322

DomainStartEndE-ValueType
coiled coil region 57 94 N/A INTRINSIC
low complexity region 241 256 N/A INTRINSIC
Pfam:Tcp10_C 261 401 3.5e-68 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 T C 1: 71,258,182 K2383R probably benign Het
Acly C T 11: 100,504,854 probably null Het
Baiap3 T A 17: 25,249,337 I276F possibly damaging Het
Cdc14b A T 13: 64,209,193 D419E probably benign Het
Celsr2 G T 3: 108,397,769 P2165T probably benign Het
Clk4 A G 11: 51,281,398 D476G probably benign Het
Dera A G 6: 137,836,880 T10A Het
Dip2c A T 13: 9,604,581 T742S probably benign Het
Dohh C A 10: 81,387,806 A231E probably benign Het
Dot1l T G 10: 80,789,368 S1150A possibly damaging Het
Eea1 T A 10: 96,026,598 I794N probably benign Het
En2 T C 5: 28,170,289 S277P probably damaging Het
Erich1 A G 8: 14,030,691 L276P probably damaging Het
Flnb A G 14: 7,924,224 N1779S probably damaging Het
Frzb T A 2: 80,424,635 T186S probably benign Het
Gdf7 T A 12: 8,298,257 R347* probably null Het
Ighv9-4 T C 12: 114,300,263 I17V not run Het
Ipo13 G A 4: 117,911,891 P235S probably benign Het
Itga2 C A 13: 114,866,260 G565C probably damaging Het
Kcnc4 CCCGCCGCCGCCGCCGCCGCCGC CCCGCCGCCGCCGCCGCCGCCGCCGC 3: 107,458,609 probably benign Het
Kcnk10 A G 12: 98,435,096 I440T probably damaging Het
Kdm3a T A 6: 71,599,492 K779N possibly damaging Het
Kmt2d C T 15: 98,862,120 D1086N unknown Het
Kntc1 A G 5: 123,759,089 I172V probably benign Het
Maip1 A G 1: 57,411,844 E215G probably damaging Het
Mms19 A T 19: 41,955,168 M417K possibly damaging Het
Mslnl T C 17: 25,743,183 V185A probably damaging Het
Naa11 A T 5: 97,391,789 V170E probably benign Het
Ncapg C T 5: 45,699,885 P980S probably benign Het
Olfr170 T C 16: 19,605,735 N310S probably benign Het
Pbxip1 A G 3: 89,448,199 D675G probably damaging Het
Pdlim5 A G 3: 142,277,847 S382P probably benign Het
Pkd1l1 T A 11: 8,854,390 I2184F Het
Plau A G 14: 20,839,798 Y237C probably damaging Het
Ppl T C 16: 5,097,942 T586A probably benign Het
Rapgef6 T G 11: 54,661,075 I923S possibly damaging Het
Rbfox2 C T 15: 77,306,494 G17D unknown Het
Sema3b T C 9: 107,603,814 D108G probably damaging Het
Slc6a20a A G 9: 123,656,266 I297T probably damaging Het
Slit1 A G 19: 41,650,689 F261L probably benign Het
Tktl2 A G 8: 66,513,101 E437G probably damaging Het
Tll1 G T 8: 64,121,492 Y109* probably null Het
Tmem79 A G 3: 88,332,581 V274A probably damaging Het
Tnfrsf23 G A 7: 143,681,462 S55L probably benign Het
Ubd T C 17: 37,193,974 probably null Het
Ubl3 C A 5: 148,506,175 R105L possibly damaging Het
Ubl7 A T 9: 57,914,584 D72V probably damaging Het
Wdr55 T C 18: 36,762,023 S81P probably damaging Het
Wtip T C 7: 34,116,619 Y344C probably damaging Het
Zfp488 A G 14: 33,970,400 S269P possibly damaging Het
Zkscan2 A C 7: 123,499,862 S36A probably benign Het
Other mutations in Tcp10a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01538:Tcp10a APN 17 7343500 missense probably damaging 1.00
IGL01868:Tcp10a APN 17 7329864 missense possibly damaging 0.79
IGL02942:Tcp10a APN 17 7329919 missense probably damaging 0.99
IGL03293:Tcp10a APN 17 7326492 missense possibly damaging 0.62
R0032:Tcp10a UTSW 17 7336907 missense probably benign 0.02
R0129:Tcp10a UTSW 17 7343504 missense probably damaging 1.00
R0271:Tcp10a UTSW 17 7331156 missense probably benign 0.06
R0352:Tcp10a UTSW 17 7326406 missense probably damaging 0.98
R0549:Tcp10a UTSW 17 7326551 missense probably benign 0.11
R1445:Tcp10a UTSW 17 7326007 critical splice donor site probably null
R2147:Tcp10a UTSW 17 7334302 missense probably damaging 0.98
R2937:Tcp10a UTSW 17 7329774 missense probably damaging 1.00
R4599:Tcp10a UTSW 17 7336924 missense probably damaging 0.99
R4601:Tcp10a UTSW 17 7325975 missense probably benign 0.01
R5982:Tcp10a UTSW 17 7345026 missense possibly damaging 0.61
R7132:Tcp10a UTSW 17 7344952 missense probably benign 0.16
R8290:Tcp10a UTSW 17 7334317 missense probably benign 0.01
Z1088:Tcp10a UTSW 17 7326449 missense probably damaging 1.00
Z1176:Tcp10a UTSW 17 7324718 start gained probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTCCACTTACCAGAGTG -3'
(R):5'- CAAGATGGTGGTGGCTACATG -3'

Sequencing Primer
(F):5'- GTCTCTATTCTACAGGAACGGAGAC -3'
(R):5'- GGTGGCTACATGGTCTCTTTCTTTAC -3'
Posted On2019-11-12