Incidental Mutation 'R7692:Vmn1r206'
ID 593461
Institutional Source Beutler Lab
Gene Symbol Vmn1r206
Ensembl Gene ENSMUSG00000101578
Gene Name vomeronasal 1 receptor 206
Synonyms V1rh7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7692 (G1)
Quality Score 225.009
Status Not validated
Chromosome 13
Chromosomal Location 22617456-22624251 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22620657 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 127 (I127F)
Ref Sequence ENSEMBL: ENSMUSP00000139772 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000187140] [ENSMUST00000227244]
AlphaFold Q8R277
Predicted Effect probably damaging
Transcript: ENSMUST00000187140
AA Change: I127F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000139772
Gene: ENSMUSG00000101578
AA Change: I127F

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
Pfam:V1R 32 297 6.7e-36 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227244
AA Change: I127F

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugdh T C 5: 65,417,615 Y356C probably damaging Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Vmn1r206
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01584:Vmn1r206 APN 13 22620794 missense probably damaging 1.00
IGL02016:Vmn1r206 APN 13 22620164 missense probably damaging 0.99
IGL02754:Vmn1r206 APN 13 22620890 nonsense probably null
R0317:Vmn1r206 UTSW 13 22620960 missense possibly damaging 0.86
R0570:Vmn1r206 UTSW 13 22620413 missense probably damaging 1.00
R1056:Vmn1r206 UTSW 13 22620614 missense probably benign 0.10
R1497:Vmn1r206 UTSW 13 22620990 missense probably benign 0.23
R2018:Vmn1r206 UTSW 13 22620188 missense probably damaging 1.00
R2128:Vmn1r206 UTSW 13 22620612 missense probably benign 0.09
R2129:Vmn1r206 UTSW 13 22620612 missense probably benign 0.09
R5159:Vmn1r206 UTSW 13 22620605 missense probably damaging 1.00
R7763:Vmn1r206 UTSW 13 22620669 missense possibly damaging 0.74
R7910:Vmn1r206 UTSW 13 22620301 nonsense probably null
R9580:Vmn1r206 UTSW 13 22620720 missense probably damaging 1.00
X0026:Vmn1r206 UTSW 13 22620554 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- CATGGCACCCTGAAATAATGCATC -3'
(R):5'- ATTGCCAAAGACAGTAGCAGC -3'

Sequencing Primer
(F):5'- TGCATCTCTCAGGACCATAAGAGG -3'
(R):5'- TGCCAAAGACAGTAGCAGCTTTTG -3'
Posted On 2019-11-12