Incidental Mutation 'R7692:Ugdh'
ID593441
Institutional Source Beutler Lab
Gene Symbol Ugdh
Ensembl Gene ENSMUSG00000029201
Gene NameUDP-glucose dehydrogenase
SynonymsUdpgdh
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.829) question?
Stock #R7692 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location65413221-65435949 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 65417615 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 356 (Y356C)
Ref Sequence ENSEMBL: ENSMUSP00000031103 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031103]
Predicted Effect probably damaging
Transcript: ENSMUST00000031103
AA Change: Y356C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000031103
Gene: ENSMUSG00000029201
AA Change: Y356C

DomainStartEndE-ValueType
Pfam:UDPG_MGDP_dh_N 5 195 1.5e-63 PFAM
Pfam:UDPG_MGDP_dh 214 309 1.8e-34 PFAM
UDPG_MGDP_dh_C 332 447 1.89e-38 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene converts UDP-glucose to UDP-glucuronate and thereby participates in the biosynthesis of glycosaminoglycans such as hyaluronan, chondroitin sulfate, and heparan sulfate. These glycosylated compounds are common components of the extracellular matrix and likely play roles in signal transduction, cell migration, and cancer growth and metastasis. The expression of this gene is up-regulated by transforming growth factor beta and down-regulated by hypoxia. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
PHENOTYPE: Mutation of this gene results in developmental arrest during gastrulation with defects in endoderm and mesoderm migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam26b G A 8: 43,520,795 T390I probably benign Het
Adgb A G 10: 10,411,712 probably null Het
Ado G T 10: 67,548,435 Y113* probably null Het
Angptl1 A G 1: 156,845,315 E237G probably damaging Het
Arid2 T A 15: 96,356,697 Y141* probably null Het
Clvs1 T C 4: 9,350,739 I183T probably benign Het
Dnah1 T C 14: 31,292,338 K1817E probably benign Het
Eif3e C A 15: 43,263,246 R271L probably damaging Het
Eml6 A G 11: 29,753,085 V1611A probably damaging Het
Enpp3 G T 10: 24,784,841 Y634* probably null Het
Evi5l C T 8: 4,200,886 R394W probably damaging Het
Fcgr3 A C 1: 171,054,092 F156V probably damaging Het
Fmo1 T A 1: 162,833,833 T294S probably benign Het
Gabrb3 A G 7: 57,816,455 Q339R probably damaging Het
Gen1 T A 12: 11,242,166 T606S probably benign Het
Gfod1 T C 13: 43,201,052 Q149R probably benign Het
Golm1 A G 13: 59,640,257 V276A probably benign Het
Hc C A 2: 35,024,149 V849F probably damaging Het
Hectd4 T C 5: 121,321,564 I832T possibly damaging Het
Hspa14 T C 2: 3,496,606 D283G probably damaging Het
Lztfl1 C T 9: 123,712,471 W94* probably null Het
Lzts3 T C 2: 130,635,386 S381G probably benign Het
Mgat2 A G 12: 69,184,670 Y6C probably damaging Het
Mrpl30 T C 1: 37,895,358 I27T probably benign Het
Muc5b A T 7: 141,853,229 T1045S unknown Het
Nlrp4a G A 7: 26,449,265 R99Q probably benign Het
Olfr1450 A G 19: 12,953,642 T18A possibly damaging Het
Olfr1510 T C 14: 52,410,488 Y128C probably damaging Het
Phlpp1 T C 1: 106,281,402 L495P probably damaging Het
Pla2g4d T C 2: 120,279,295 D178G possibly damaging Het
Prl5a1 C G 13: 28,150,014 L167V probably damaging Het
Sardh A G 2: 27,197,639 V740A probably benign Het
Sbno1 T G 5: 124,405,646 T277P probably benign Het
Slc2a1 T C 4: 119,136,265 V433A probably damaging Het
Slc4a10 T C 2: 62,303,964 V1008A possibly damaging Het
Smarcal1 T G 1: 72,586,020 S109A probably benign Het
Speg A G 1: 75,401,190 D864G probably benign Het
Steap4 T C 5: 7,976,976 I313T probably benign Het
Tab2 A T 10: 7,911,105 D614E probably damaging Het
Tenm4 A G 7: 96,895,403 K2246E probably damaging Het
Timm23 A G 14: 32,180,563 S208P probably damaging Het
Tmem229a C A 6: 24,955,212 C181F probably benign Het
Ugt2a1 A G 5: 87,486,727 L7P probably damaging Het
Uhrf1 A G 17: 56,312,905 D272G possibly damaging Het
Vmn1r206 T A 13: 22,620,657 I127F probably damaging Het
Vmn2r106 T C 17: 20,285,228 Y68C possibly damaging Het
Zfand6 G A 7: 84,633,933 P72L not run Het
Other mutations in Ugdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01630:Ugdh APN 5 65416905 missense probably benign 0.12
IGL01734:Ugdh APN 5 65422688 missense probably benign
IGL02157:Ugdh APN 5 65422692 missense probably damaging 0.99
R1677:Ugdh UTSW 5 65423178 missense probably damaging 1.00
R1836:Ugdh UTSW 5 65420291 nonsense probably null
R1882:Ugdh UTSW 5 65423596 missense possibly damaging 0.86
R2020:Ugdh UTSW 5 65416925 missense probably damaging 1.00
R2166:Ugdh UTSW 5 65417014 splice site probably benign
R2256:Ugdh UTSW 5 65417115 splice site probably benign
R2257:Ugdh UTSW 5 65417115 splice site probably benign
R2332:Ugdh UTSW 5 65427484 missense possibly damaging 0.63
R4707:Ugdh UTSW 5 65423352 splice site probably null
R4913:Ugdh UTSW 5 65423448 critical splice donor site probably null
R5590:Ugdh UTSW 5 65422874 unclassified probably benign
R5644:Ugdh UTSW 5 65416861 missense probably benign 0.04
R5741:Ugdh UTSW 5 65427523 missense probably damaging 0.99
R6151:Ugdh UTSW 5 65417581 nonsense probably null
R6525:Ugdh UTSW 5 65417059 missense probably damaging 1.00
R6897:Ugdh UTSW 5 65427433 missense probably benign 0.07
R7155:Ugdh UTSW 5 65417037 missense probably damaging 1.00
R8178:Ugdh UTSW 5 65423662 splice site probably null
R8485:Ugdh UTSW 5 65427559 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TCATTCAAAGACAAGCCAGCTG -3'
(R):5'- AGAAGAGGACCTGTGTGTCTCC -3'

Sequencing Primer
(F):5'- ACAAGCCAGCTGTGTGG -3'
(R):5'- AAGAGGACCTGTGTGTCTCCTTTTTC -3'
Posted On2019-11-12