Incidental Mutation 'R7767:Nphs1'
ID 598294
Institutional Source Beutler Lab
Gene Symbol Nphs1
Ensembl Gene ENSMUSG00000006649
Gene Name nephrosis 1, nephrin
Synonyms nephrin
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7767 (G1)
Quality Score 225.009
Status Not validated
Chromosome 7
Chromosomal Location 30458315-30487223 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 30463308 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Valine at position 404 (D404V)
Ref Sequence ENSEMBL: ENSMUSP00000006825 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006825] [ENSMUST00000126297]
AlphaFold Q9QZS7
Predicted Effect probably damaging
Transcript: ENSMUST00000006825
AA Change: D404V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000006825
Gene: ENSMUSG00000006649
AA Change: D404V

DomainStartEndE-ValueType
signal peptide 1 36 N/A INTRINSIC
IG 52 146 1.38e-6 SMART
Pfam:C2-set_2 152 242 4.1e-20 PFAM
IG 264 351 9.86e-3 SMART
IG_like 360 452 2.73e1 SMART
IG 464 556 2.99e-2 SMART
IG_like 572 644 8.9e-1 SMART
IG 667 751 1.32e-3 SMART
IG 760 849 7.3e-6 SMART
IGc2 868 941 5.4e-9 SMART
FN3 955 1036 1.01e-11 SMART
transmembrane domain 1078 1100 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000126297
AA Change: D390V

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116500
Gene: ENSMUSG00000006649
AA Change: D390V

DomainStartEndE-ValueType
IG 38 132 1.38e-6 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the immunoglobulin family of cell adhesion molecules that functions in the glomerular filtration barrier in the kidney. The gene is primarily expressed in renal tissues, and the protein is a type-1 transmembrane protein found at the slit diaphragm of glomerular podocytes. The slit diaphragm is thought to function as an ultrafilter to exclude albumin and other plasma macromolecules in the formation of urine. Mutations in this gene result in Finnish-type congenital nephrosis 1, characterized by severe proteinuria and loss of the slit diaphragm and foot processes.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit severe proteinuria associated with kidney defects and die soon after birth. Heterozygotes exhibit fusion of one-third of glomerular foot processes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik G T 3: 36,920,287 probably null Het
Aox4 C A 1: 58,235,207 S384Y probably damaging Het
Arhgef15 T C 11: 68,953,847 E308G probably damaging Het
Asb15 A G 6: 24,559,282 D142G probably benign Het
Atg13 A G 2: 91,679,366 S394P probably damaging Het
Atp10a G C 7: 58,658,849 W132S probably damaging Het
BC003331 A G 1: 150,372,037 V387A probably benign Het
Bod1l T A 5: 41,816,756 N2405I probably benign Het
Capsl C T 15: 9,462,684 R137C probably damaging Het
Cd109 T A 9: 78,710,159 M1313K probably damaging Het
Chst13 G A 6: 90,309,584 A132V possibly damaging Het
Cobl T C 11: 12,412,117 probably benign Het
Coq9 A T 8: 94,850,586 E193V probably benign Het
Cpd T A 11: 76,813,559 I410F probably benign Het
Cyth3 T G 5: 143,707,474 V351G probably damaging Het
Dcdc2c T C 12: 28,470,257 K607E Het
Dcp1a T C 14: 30,479,818 probably null Het
Dennd3 A G 15: 73,522,230 I35V probably benign Het
Dlgap4 C T 2: 156,746,053 R606W probably damaging Het
Dnhd1 A G 7: 105,694,610 I1720M probably benign Het
Erbin A G 13: 103,859,399 L265P probably damaging Het
Ern1 T C 11: 106,400,308 D847G probably damaging Het
Esyt3 T G 9: 99,324,971 S342R probably benign Het
Exoc2 A T 13: 30,876,769 I584K probably benign Het
Fam240a T C 9: 110,915,022 R50G probably damaging Het
Glis3 A T 19: 28,263,960 M858K probably benign Het
Gls2 C T 10: 128,195,129 R86C unknown Het
Gm10972 C A 3: 94,643,594 Y25* probably null Het
H2-T10 A T 17: 36,117,730 M350K probably benign Het
Has1 A T 17: 17,850,530 V43D probably damaging Het
Herc2 T A 7: 56,228,527 S4609R probably benign Het
Hmgcs2 A C 3: 98,291,266 T162P probably damaging Het
Hspg2 G T 4: 137,511,866 C368F probably damaging Het
Ighv11-1 A G 12: 113,982,102 S44P probably damaging Het
Inppl1 A G 7: 101,824,338 V1035A probably benign Het
Kmt2a C T 9: 44,818,998 V3341I unknown Het
Lrp1b T C 2: 40,801,505 N3434S Het
Lrriq1 G C 10: 103,215,954 S312R probably damaging Het
Map1a G A 2: 121,302,036 S1111N probably damaging Het
Myo15 T C 11: 60,502,096 V1029A Het
Nol11 T C 11: 107,179,082 H314R possibly damaging Het
Olfr550 A T 7: 102,571,764 probably benign Het
Pabpc2 T C 18: 39,774,554 Y291H possibly damaging Het
Pcdh15 G A 10: 74,486,256 A1020T probably benign Het
Pla2g4f A C 2: 120,305,009 S395A possibly damaging Het
Ppp1r18 A G 17: 35,867,284 Q17R probably damaging Het
Prokr2 A T 2: 132,374,076 V155D probably damaging Het
Pwwp2a T G 11: 43,705,869 C620W probably damaging Het
Rabepk T C 2: 34,785,593 D175G probably damaging Het
Rad54l T C 4: 116,099,669 Y485C probably damaging Het
Rasef A G 4: 73,734,534 S577P probably damaging Het
Rgma C A 7: 73,418,004 L446I unknown Het
Rnf212b T C 14: 54,842,368 S182P probably damaging Het
Rnf6 C A 5: 146,211,176 R344I probably damaging Het
Rnf6 T A 5: 146,211,177 R344* probably null Het
Sgo1 A G 17: 53,679,611 I184T possibly damaging Het
Sgpl1 A T 10: 61,117,723 I78N possibly damaging Het
Snx13 T A 12: 35,107,484 Y510N probably damaging Het
Sptbn2 G A 19: 4,734,143 E638K possibly damaging Het
Sspo A G 6: 48,451,382 T349A probably damaging Het
Sv2c C T 13: 95,989,715 S343N probably damaging Het
Syne1 C A 10: 5,333,560 V1502F possibly damaging Het
Syne1 T A 10: 5,333,632 I1478F possibly damaging Het
Tmem121 C T 12: 113,188,372 A70V probably damaging Het
Tmem215 A G 4: 40,474,042 I40V possibly damaging Het
Trim25 A G 11: 89,009,117 probably null Het
Trio A G 15: 27,889,418 V534A unknown Het
Tyr T A 7: 87,493,010 E114V probably benign Het
Ush2a A T 1: 188,553,260 T1998S probably benign Het
Usp40 G T 1: 87,982,178 A518E probably benign Het
Usp48 T A 4: 137,604,645 probably null Het
Vash1 T A 12: 86,686,993 F152L probably damaging Het
Vsig10l C A 7: 43,463,717 P31Q probably damaging Het
Xab2 C T 8: 3,619,018 E43K probably benign Het
Zfp423 G A 8: 87,780,884 S944F probably damaging Het
Zp2 A T 7: 120,137,169 D350E probably benign Het
Zscan4e T G 7: 11,307,534 Q165P probably damaging Het
Other mutations in Nphs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Nphs1 APN 7 30482551 missense possibly damaging 0.77
IGL00927:Nphs1 APN 7 30460739 unclassified probably benign
IGL00976:Nphs1 APN 7 30460685 missense possibly damaging 0.78
IGL01397:Nphs1 APN 7 30486664 missense probably benign 0.01
IGL01465:Nphs1 APN 7 30486714 makesense probably null
IGL01889:Nphs1 APN 7 30460511 missense probably damaging 1.00
IGL02383:Nphs1 APN 7 30481635 splice site probably benign
R0020:Nphs1 UTSW 7 30463208 missense probably benign 0.01
R0485:Nphs1 UTSW 7 30467515 missense probably benign
R1024:Nphs1 UTSW 7 30474277 missense probably damaging 1.00
R1115:Nphs1 UTSW 7 30481378 splice site probably benign
R1144:Nphs1 UTSW 7 30481678 splice site probably benign
R1289:Nphs1 UTSW 7 30471178 missense probably damaging 1.00
R1317:Nphs1 UTSW 7 30481831 splice site probably benign
R1617:Nphs1 UTSW 7 30482531 missense probably benign
R1756:Nphs1 UTSW 7 30461534 missense probably benign 0.00
R1937:Nphs1 UTSW 7 30474373 missense probably damaging 1.00
R2144:Nphs1 UTSW 7 30460970 missense probably benign 0.13
R2256:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2257:Nphs1 UTSW 7 30467992 missense possibly damaging 0.94
R2277:Nphs1 UTSW 7 30467564 nonsense probably null
R3104:Nphs1 UTSW 7 30467540 nonsense probably null
R3106:Nphs1 UTSW 7 30467540 nonsense probably null
R3151:Nphs1 UTSW 7 30460240 missense probably benign
R3765:Nphs1 UTSW 7 30471210 missense probably damaging 0.98
R4078:Nphs1 UTSW 7 30467520 nonsense probably null
R4397:Nphs1 UTSW 7 30481965 splice site probably null
R4635:Nphs1 UTSW 7 30468007 missense probably benign 0.39
R4650:Nphs1 UTSW 7 30482470 missense probably benign 0.21
R4811:Nphs1 UTSW 7 30460429 missense probably damaging 1.00
R4850:Nphs1 UTSW 7 30463232 missense possibly damaging 0.78
R5272:Nphs1 UTSW 7 30481642 missense possibly damaging 0.86
R5327:Nphs1 UTSW 7 30463825 missense probably benign 0.00
R5681:Nphs1 UTSW 7 30486625 missense probably benign 0.00
R5865:Nphs1 UTSW 7 30474385 missense probably damaging 1.00
R5975:Nphs1 UTSW 7 30466115 missense possibly damaging 0.82
R6186:Nphs1 UTSW 7 30465634 missense probably damaging 0.98
R6198:Nphs1 UTSW 7 30467915 missense probably damaging 0.97
R6353:Nphs1 UTSW 7 30474544 missense probably damaging 0.99
R7405:Nphs1 UTSW 7 30462828 missense possibly damaging 0.46
R7647:Nphs1 UTSW 7 30481965 splice site probably null
R8132:Nphs1 UTSW 7 30482053 missense probably benign 0.02
R8485:Nphs1 UTSW 7 30466173 missense probably damaging 0.98
R8678:Nphs1 UTSW 7 30463859 missense probably damaging 1.00
R8890:Nphs1 UTSW 7 30462655 missense probably damaging 1.00
R8946:Nphs1 UTSW 7 30463200 missense probably damaging 1.00
R9133:Nphs1 UTSW 7 30460667 nonsense probably null
R9159:Nphs1 UTSW 7 30465601 missense possibly damaging 0.93
R9347:Nphs1 UTSW 7 30471169 missense probably damaging 1.00
R9547:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9548:Nphs1 UTSW 7 30481450 missense probably benign 0.00
R9607:Nphs1 UTSW 7 30463587 missense probably damaging 1.00
R9626:Nphs1 UTSW 7 30467566 missense probably benign 0.16
R9720:Nphs1 UTSW 7 30466074 missense possibly damaging 0.83
R9733:Nphs1 UTSW 7 30467530 missense probably damaging 1.00
X0028:Nphs1 UTSW 7 30467504 missense probably null 0.01
Z1177:Nphs1 UTSW 7 30470903 missense probably damaging 1.00
Z1186:Nphs1 UTSW 7 30460350 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACCCTGGCCTGAATTCC -3'
(R):5'- GGAGTGAGCTTCAGATTTACGG -3'

Sequencing Primer
(F):5'- GAATTCCCATCTCTCCTTGGTGTG -3'
(R):5'- CTTCAGATTTACGGCCCGAGAAG -3'
Posted On 2019-11-26