Incidental Mutation 'R7797:Kif1b'
ID600271
Institutional Source Beutler Lab
Gene Symbol Kif1b
Ensembl Gene ENSMUSG00000063077
Gene Namekinesin family member 1B
SynonymsKif1b beta, KIF1Bp130, A530096N05Rik, D4Mil1e, Kif1b alpha, N-3 kinesin, KIF1Bp204
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7797 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location149176319-149307693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 149237387 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 1025 (Q1025L)
Ref Sequence ENSEMBL: ENSMUSP00000030806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030806] [ENSMUST00000055647] [ENSMUST00000060537]
Predicted Effect probably benign
Transcript: ENSMUST00000030806
AA Change: Q1025L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000030806
Gene: ENSMUSG00000063077
AA Change: Q1025L

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 660 N/A INTRINSIC
coiled coil region 814 858 N/A INTRINSIC
low complexity region 889 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000055647
SMART Domains Protein: ENSMUSP00000061472
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 356 5.85e-176 SMART
low complexity region 389 404 N/A INTRINSIC
FHA 509 566 1.61e-4 SMART
coiled coil region 626 685 N/A INTRINSIC
Pfam:KIF1B 799 846 9.7e-13 PFAM
internal_repeat_1 901 933 7.01e-7 PROSPERO
low complexity region 1165 1179 N/A INTRINSIC
Pfam:DUF3694 1220 1368 1.1e-46 PFAM
low complexity region 1444 1461 N/A INTRINSIC
low complexity region 1479 1507 N/A INTRINSIC
low complexity region 1573 1591 N/A INTRINSIC
PH 1656 1755 1.02e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000060537
SMART Domains Protein: ENSMUSP00000056754
Gene: ENSMUSG00000063077

DomainStartEndE-ValueType
KISc 3 362 7.61e-175 SMART
low complexity region 390 400 N/A INTRINSIC
low complexity region 432 450 N/A INTRINSIC
FHA 555 612 1.61e-4 SMART
coiled coil region 672 731 N/A INTRINSIC
Pfam:KIF1B 845 892 7.1e-15 PFAM
internal_repeat_1 947 979 4.76e-7 PROSPERO
low complexity region 1211 1225 N/A INTRINSIC
Pfam:DUF3694 1266 1413 1.1e-40 PFAM
low complexity region 1490 1507 N/A INTRINSIC
low complexity region 1525 1553 N/A INTRINSIC
low complexity region 1619 1637 N/A INTRINSIC
PH 1702 1801 1.02e-14 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a motor protein that transports mitochondria and synaptic vesicle precursors. Mutations in this gene cause Charcot-Marie-Tooth disease, type 2A1. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit reduced brain size, elevated pain threshold, and neonatal death from apnea. Heterozygotes exhibit impaired synaptic vesicle precursor transport and progressive muscle weakness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921501E09Rik T C 17: 33,067,690 D46G probably damaging Het
9230110C19Rik G T 9: 8,027,129 P136Q possibly damaging Het
Abca8b A G 11: 109,971,683 probably null Het
Adam3 T G 8: 24,694,644 N535T probably damaging Het
Adamts4 A G 1: 171,257,818 K679E probably damaging Het
Arnt G A 3: 95,480,261 probably null Het
Asah2 A G 19: 32,022,361 F321L probably damaging Het
Asb15 T C 6: 24,562,506 S156P probably damaging Het
Baiap2l1 A C 5: 144,318,950 S65A probably damaging Het
Bend7 T G 2: 4,749,644 M186R probably damaging Het
Blnk T C 19: 40,959,788 K146E possibly damaging Het
Cd19 A G 7: 126,413,508 W238R probably damaging Het
Cd44 T A 2: 102,848,734 N241I probably benign Het
Cdh23 T C 10: 60,385,194 E1257G probably benign Het
Cntnap5c T C 17: 58,359,275 V1100A probably benign Het
Cul7 T C 17: 46,658,642 V945A possibly damaging Het
Dock2 C T 11: 34,282,652 C1116Y probably damaging Het
Ehbp1 T C 11: 22,096,109 M547V possibly damaging Het
Fam50b G A 13: 34,747,101 E187K possibly damaging Het
Gm5346 T A 8: 43,626,374 E271V probably benign Het
Grhl3 C G 4: 135,559,105 K88N possibly damaging Het
Hbb-y T A 7: 103,851,881 Y146F probably damaging Het
Hivep2 T C 10: 14,130,103 V815A probably benign Het
Hoxa7 T A 6: 52,215,890 I173F probably damaging Het
Igkv1-110 T G 6: 68,270,993 S29A probably benign Het
Jade2 A G 11: 51,817,299 S696P probably benign Het
Kif2c A T 4: 117,171,743 C241S probably benign Het
Kmt2d G T 15: 98,864,406 H400N probably benign Het
Krt35 T A 11: 100,094,887 N174Y probably damaging Het
Ldlrad1 G A 4: 107,209,491 A8T probably benign Het
Magi3 A G 3: 104,051,302 V489A probably damaging Het
Mapk7 T C 11: 61,489,415 E739G possibly damaging Het
Mcidas G A 13: 112,998,987 G315S probably damaging Het
Mdga1 C T 17: 29,842,840 probably null Het
Megf8 G A 7: 25,334,597 R607H probably damaging Het
Met T A 6: 17,533,953 N634K probably damaging Het
Miip C T 4: 147,862,918 G236S probably benign Het
Mmp11 G T 10: 75,923,480 T107K Het
Mroh2b A C 15: 4,949,105 N1378H probably benign Het
Naa15 G A 3: 51,448,610 C322Y probably damaging Het
Naip1 T A 13: 100,444,478 Y87F probably damaging Het
Ngrn A G 7: 80,264,437 D112G probably benign Het
Osbpl1a C A 18: 12,882,264 C369F probably damaging Het
Pcnx2 G C 8: 125,785,348 D1406E possibly damaging Het
Pold1 G A 7: 44,541,789 P206L probably benign Het
Psen1 A G 12: 83,699,622 S20G probably benign Het
Ptpn23 C T 9: 110,393,807 D61N possibly damaging Het
Rbfox3 A T 11: 118,496,484 L268Q possibly damaging Het
Rbm22 A G 18: 60,561,272 T26A probably damaging Het
Rpgrip1 G A 14: 52,133,820 R332Q possibly damaging Het
Rrm2b A T 15: 37,927,261 L347* probably null Het
Rsf1 A T 7: 97,661,485 D474V Het
Ryr2 C T 13: 11,801,180 R640Q probably damaging Het
Sec16b A G 1: 157,561,675 E691G unknown Het
Sept1 A T 7: 127,214,765 V365E unknown Het
Tlk2 A G 11: 105,210,618 H114R probably benign Het
Tmem200a A G 10: 25,993,966 I135T possibly damaging Het
Tpst2 T A 5: 112,307,916 V107E probably damaging Het
Trim30a A T 7: 104,411,200 D456E possibly damaging Het
Ttll3 T C 6: 113,394,777 V45A possibly damaging Het
Ulk2 A G 11: 61,782,102 Y889H probably benign Het
Umodl1 A G 17: 30,959,151 S34G probably benign Het
Vmn1r67 A G 7: 10,446,976 I56V probably benign Het
Vmn2r120 C T 17: 57,508,874 G827E probably damaging Het
Zc3h6 T C 2: 129,015,635 probably null Het
Other mutations in Kif1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Kif1b APN 4 149220602 missense probably damaging 1.00
IGL01943:Kif1b APN 4 149214905 critical splice donor site probably null
IGL02240:Kif1b APN 4 149246414 missense probably damaging 1.00
IGL02414:Kif1b APN 4 149199314 missense probably damaging 0.96
IGL02490:Kif1b APN 4 149204208 missense probably benign
IGL02501:Kif1b APN 4 149214976 missense probably damaging 1.00
IGL02833:Kif1b APN 4 149246364 missense probably damaging 1.00
IGL02852:Kif1b APN 4 149291328 missense probably damaging 1.00
IGL02900:Kif1b APN 4 149180809 missense possibly damaging 0.81
IGL03287:Kif1b APN 4 149214981 missense possibly damaging 0.67
IGL03412:Kif1b APN 4 149274939 missense probably benign 0.00
PIT4305001:Kif1b UTSW 4 149220792 critical splice acceptor site probably null
R0005:Kif1b UTSW 4 149181927 missense probably damaging 1.00
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0044:Kif1b UTSW 4 149263601 splice site probably benign
R0129:Kif1b UTSW 4 149261201 missense probably benign
R0180:Kif1b UTSW 4 149213659 missense probably damaging 1.00
R0288:Kif1b UTSW 4 149199338 missense probably damaging 1.00
R0360:Kif1b UTSW 4 149262729 missense probably damaging 1.00
R0383:Kif1b UTSW 4 149202512 missense probably damaging 1.00
R0398:Kif1b UTSW 4 149204231 missense possibly damaging 0.89
R0403:Kif1b UTSW 4 149181967 nonsense probably null
R0445:Kif1b UTSW 4 149188009 missense probably benign 0.01
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1466:Kif1b UTSW 4 149223252 missense probably damaging 0.99
R1681:Kif1b UTSW 4 149195501 critical splice acceptor site probably null
R1728:Kif1b UTSW 4 149187722 missense probably damaging 0.99
R1840:Kif1b UTSW 4 149188132 missense probably damaging 1.00
R1874:Kif1b UTSW 4 149187632 missense probably benign
R1915:Kif1b UTSW 4 149267216 missense probably damaging 1.00
R2106:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2124:Kif1b UTSW 4 149222296 missense probably benign 0.08
R2126:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2127:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2128:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2129:Kif1b UTSW 4 149187640 missense possibly damaging 0.92
R2146:Kif1b UTSW 4 149184309 missense probably damaging 0.99
R2255:Kif1b UTSW 4 149274997 missense probably damaging 1.00
R2392:Kif1b UTSW 4 149220620 missense possibly damaging 0.93
R2883:Kif1b UTSW 4 149237648 missense possibly damaging 0.78
R2981:Kif1b UTSW 4 149220541 critical splice donor site probably null
R3038:Kif1b UTSW 4 149213333 missense probably benign 0.02
R3616:Kif1b UTSW 4 149262283 splice site probably benign
R3935:Kif1b UTSW 4 149237160 missense probably benign 0.00
R4347:Kif1b UTSW 4 149247234 missense probably damaging 1.00
R4423:Kif1b UTSW 4 149214105 missense probably damaging 0.99
R4637:Kif1b UTSW 4 149199311 missense probably damaging 0.97
R4745:Kif1b UTSW 4 149237882 nonsense probably null
R4807:Kif1b UTSW 4 149247921 intron probably benign
R5618:Kif1b UTSW 4 149269889 missense possibly damaging 0.94
R5644:Kif1b UTSW 4 149238482 missense probably damaging 0.96
R5683:Kif1b UTSW 4 149222261 missense probably damaging 1.00
R5696:Kif1b UTSW 4 149273849 splice site probably null
R6022:Kif1b UTSW 4 149198532 missense probably benign 0.01
R6048:Kif1b UTSW 4 149263629 missense probably damaging 1.00
R6137:Kif1b UTSW 4 149238426 missense possibly damaging 0.47
R6139:Kif1b UTSW 4 149237532 missense possibly damaging 0.88
R6171:Kif1b UTSW 4 149258048 missense probably damaging 1.00
R6250:Kif1b UTSW 4 149213643 missense probably benign 0.00
R6423:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6424:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6425:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6443:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6460:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6462:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6463:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6469:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6470:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6471:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6472:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6504:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6536:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6537:Kif1b UTSW 4 149192596 missense probably benign 0.16
R6668:Kif1b UTSW 4 149213407 missense probably benign 0.09
R6698:Kif1b UTSW 4 149274956 missense probably damaging 0.99
R7065:Kif1b UTSW 4 149202525 missense possibly damaging 0.46
R7222:Kif1b UTSW 4 149225157 missense probably damaging 1.00
R7342:Kif1b UTSW 4 149214090 missense possibly damaging 0.94
R7720:Kif1b UTSW 4 149182355 missense probably benign 0.01
R7744:Kif1b UTSW 4 149237075 missense possibly damaging 0.83
R7829:Kif1b UTSW 4 149220990 splice site probably null
R7869:Kif1b UTSW 4 149184376 missense probably benign 0.01
R7878:Kif1b UTSW 4 149214997 missense probably damaging 0.98
R7980:Kif1b UTSW 4 149269921 missense probably damaging 1.00
R8047:Kif1b UTSW 4 149214922 missense probably damaging 1.00
R8237:Kif1b UTSW 4 149191185 missense probably benign 0.10
R8243:Kif1b UTSW 4 149204267 missense probably benign
R8252:Kif1b UTSW 4 149273805 missense probably damaging 1.00
R8342:Kif1b UTSW 4 149222348 missense probably damaging 0.96
R8460:Kif1b UTSW 4 149187620 missense possibly damaging 0.93
R8462:Kif1b UTSW 4 149182340 missense probably benign 0.05
R8496:Kif1b UTSW 4 149192611 nonsense probably null
R8687:Kif1b UTSW 4 149261163 nonsense probably null
R8694:Kif1b UTSW 4 149220567 missense probably damaging 0.98
R8842:Kif1b UTSW 4 149253739 missense probably damaging 0.98
RF008:Kif1b UTSW 4 149251738 splice site probably null
X0009:Kif1b UTSW 4 149247264 missense probably damaging 1.00
X0062:Kif1b UTSW 4 149275005 missense probably damaging 1.00
Z1176:Kif1b UTSW 4 149266298 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- AAAGTTTGTAGATCAGCGGTGG -3'
(R):5'- TTCATCCCTCCTGAGAACCG -3'

Sequencing Primer
(F):5'- GGGTGACCGCTGTGGGAG -3'
(R):5'- TCCTGAGAACCGGAAGCC -3'
Posted On2019-11-26