Incidental Mutation 'R7855:2700081O15Rik'
ID607219
Institutional Source Beutler Lab
Gene Symbol 2700081O15Rik
Ensembl Gene ENSMUSG00000053080
Gene NameRIKEN cDNA 2700081O15 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R7855 (G1)
Quality Score211.009
Status Not validated
Chromosome19
Chromosomal Location7417625-7425904 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7422256 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 456 (I456N)
Ref Sequence ENSEMBL: ENSMUSP00000123773 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025667] [ENSMUST00000065304] [ENSMUST00000088169] [ENSMUST00000088171] [ENSMUST00000159348] [ENSMUST00000161907]
Predicted Effect probably benign
Transcript: ENSMUST00000025667
SMART Domains Protein: ENSMUSP00000025667
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
Pfam:Reticulon 49 219 8.7e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000065304
SMART Domains Protein: ENSMUSP00000065810
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
low complexity region 80 91 N/A INTRINSIC
low complexity region 119 131 N/A INTRINSIC
low complexity region 516 527 N/A INTRINSIC
low complexity region 639 650 N/A INTRINSIC
Pfam:Reticulon 776 940 9.1e-45 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088169
SMART Domains Protein: ENSMUSP00000085494
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 40 N/A INTRINSIC
low complexity region 42 66 N/A INTRINSIC
Pfam:Reticulon 68 238 1.1e-57 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000088171
SMART Domains Protein: ENSMUSP00000085496
Gene: ENSMUSG00000024758

DomainStartEndE-ValueType
low complexity region 4 56 N/A INTRINSIC
low complexity region 61 72 N/A INTRINSIC
low complexity region 100 112 N/A INTRINSIC
low complexity region 497 508 N/A INTRINSIC
low complexity region 620 631 N/A INTRINSIC
Pfam:Reticulon 757 927 1.8e-56 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000124442
Gene: ENSMUSG00000053080
AA Change: I251N

DomainStartEndE-ValueType
coiled coil region 14 41 N/A INTRINSIC
low complexity region 42 67 N/A INTRINSIC
low complexity region 72 97 N/A INTRINSIC
low complexity region 178 215 N/A INTRINSIC
ZnF_C2H2 231 256 2.06e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000159348
AA Change: I456N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123773
Gene: ENSMUSG00000053080
AA Change: I456N

DomainStartEndE-ValueType
low complexity region 3 20 N/A INTRINSIC
low complexity region 46 58 N/A INTRINSIC
low complexity region 66 78 N/A INTRINSIC
low complexity region 99 108 N/A INTRINSIC
ZnF_C2H2 124 149 3.38e1 SMART
low complexity region 171 201 N/A INTRINSIC
low complexity region 205 230 N/A INTRINSIC
low complexity region 235 260 N/A INTRINSIC
ZnF_C2H2 283 308 1.06e2 SMART
low complexity region 382 419 N/A INTRINSIC
ZnF_C2H2 435 460 2.06e1 SMART
low complexity region 491 522 N/A INTRINSIC
low complexity region 540 547 N/A INTRINSIC
low complexity region 557 572 N/A INTRINSIC
ZnF_C2H2 600 625 2.54e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000161907
SMART Domains Protein: ENSMUSP00000139847
Gene: ENSMUSG00000053080

DomainStartEndE-ValueType
low complexity region 12 24 N/A INTRINSIC
low complexity region 45 54 N/A INTRINSIC
ZnF_C2H2 70 95 1.4e-1 SMART
coiled coil region 124 151 N/A INTRINSIC
low complexity region 173 180 N/A INTRINSIC
low complexity region 190 205 N/A INTRINSIC
ZnF_C2H2 233 258 1.1e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000191580
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca6 A T 11: 110,191,628 V1173D probably benign Het
Ace A T 11: 105,972,379 M327L probably benign Het
Bcl2l2 C T 14: 54,884,379 probably benign Het
Bicdl2 C T 17: 23,666,017 Q231* probably null Het
Brms1l A T 12: 55,866,053 D277V possibly damaging Het
Cd38 C A 5: 43,901,448 L135M probably damaging Het
Col6a3 G T 1: 90,810,621 P1059T possibly damaging Het
Coro1c A T 5: 113,848,597 M262K probably benign Het
Cpxm2 G T 7: 132,057,695 P481Q possibly damaging Het
Dnah12 G T 14: 26,829,329 V2543F probably benign Het
Dock2 A C 11: 34,273,698 D1145E probably damaging Het
Elf3 G A 1: 135,254,352 R364W probably damaging Het
Eln AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC 5: 134,711,081 probably benign Het
Epha3 A G 16: 63,773,560 I55T probably damaging Het
Fam69c G A 18: 84,730,046 probably benign Het
Gfer C A 17: 24,694,285 D198Y probably damaging Het
Gm10436 A T 12: 88,176,083 I450N probably benign Het
Gm11568 A T 11: 99,858,184 T72S unknown Het
Gm21994 C T 2: 150,255,146 R121Q probably benign Het
Gm5415 A C 1: 32,546,033 I265M probably damaging Het
Igkv3-1 C T 6: 70,704,069 A84V probably benign Het
Il1rl2 A C 1: 40,343,119 Y197S probably damaging Het
Il2ra T C 2: 11,680,336 I161T possibly damaging Het
Itgb8 C T 12: 119,166,772 R667H probably benign Het
Kcnh7 G A 2: 62,837,194 Q334* probably null Het
Lctl A C 9: 64,133,216 R480S possibly damaging Het
Lrba T G 3: 86,315,430 I617S possibly damaging Het
Marf1 G T 16: 14,114,201 H1651N probably benign Het
Mitf T A 6: 97,993,196 Y142N probably damaging Het
Olfr569 A G 7: 102,887,628 V175A probably benign Het
Olfr620 T A 7: 103,611,772 I194F possibly damaging Het
Pecam1 A G 11: 106,671,750 V708A probably benign Het
Pinlyp C T 7: 24,542,440 probably null Het
Polh G A 17: 46,175,248 R382W probably damaging Het
Prdm10 A G 9: 31,327,474 I221V probably benign Het
Pskh1 G T 8: 105,913,090 R134L probably benign Het
Ptpre A G 7: 135,651,995 N6D probably benign Het
Rasgrp4 C T 7: 29,150,610 P58L unknown Het
Rhbdf2 G T 11: 116,602,240 C393* probably null Het
Rlf T C 4: 121,182,691 I174M possibly damaging Het
Ryr2 T A 13: 11,706,623 R2641* probably null Het
Simc1 A G 13: 54,524,832 H331R probably benign Het
Skp2 A G 15: 9,122,241 S256P probably benign Het
Smarcd2 T C 11: 106,267,566 R10G probably benign Het
Spef2 A G 15: 9,687,895 L480P possibly damaging Het
Tenm4 A G 7: 96,873,874 H1541R probably damaging Het
Top1 T A 2: 160,714,088 L489Q probably damaging Het
Ttll13 C T 7: 80,254,097 H258Y probably damaging Het
Unc80 A G 1: 66,483,349 R237G possibly damaging Het
Vmn1r55 A G 7: 5,146,624 F267L probably benign Het
Vmn2r96 T A 17: 18,597,868 M761K possibly damaging Het
Vps33a G A 5: 123,570,979 H58Y possibly damaging Het
Zfp354c TCACACTCGGCACA TCACA 11: 50,815,240 probably benign Het
Zfp467 T C 6: 48,439,181 Q179R probably damaging Het
Zfp729a A T 13: 67,619,948 S721T possibly damaging Het
Other mutations in 2700081O15Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02376:2700081O15Rik APN 19 7422376 missense probably damaging 1.00
IGL02814:2700081O15Rik APN 19 7420422 missense possibly damaging 0.94
H8562:2700081O15Rik UTSW 19 7422921 missense probably benign 0.01
R0034:2700081O15Rik UTSW 19 7420359 missense probably damaging 1.00
R0583:2700081O15Rik UTSW 19 7420274 missense probably damaging 1.00
R2351:2700081O15Rik UTSW 19 7422244 missense probably damaging 1.00
R4326:2700081O15Rik UTSW 19 7421226 intron probably benign
R4329:2700081O15Rik UTSW 19 7421226 intron probably benign
R5474:2700081O15Rik UTSW 19 7420159 missense probably damaging 1.00
R5735:2700081O15Rik UTSW 19 7422796 missense probably benign
R6168:2700081O15Rik UTSW 19 7422940 missense probably benign 0.40
R6739:2700081O15Rik UTSW 19 7421347 nonsense probably null
R7780:2700081O15Rik UTSW 19 7422372 missense probably damaging 0.96
R7938:2700081O15Rik UTSW 19 7422256 missense probably damaging 1.00
Z1176:2700081O15Rik UTSW 19 7422747 missense unknown
Predicted Primers PCR Primer
(F):5'- TGGGTAAGGACAACACAGCC -3'
(R):5'- GAGCGAGTGCCATCAATCAG -3'

Sequencing Primer
(F):5'- CCTGACCAGAAAGAGCCGG -3'
(R):5'- GTGCCATCAATCAGGCCCAG -3'
Posted On2019-12-20