Mutagenetix > Incidental Mutation

Incidental Mutation 'R7855:Abca6'

607200

Institutional Source

Beutler Lab

Gene Symbol

Abca6

Ensembl Gene

ENSMUSG00000044749

Gene Name

ATP-binding cassette, sub-family A (ABC1), member 6

Synonyms

6330565N06Rik

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7855 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

110176820-110251776 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 110191628 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Aspartic acid at position 1173 (V1173D)

Ref Sequence

ENSEMBL: ENSMUSP00000035458 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044003]

AlphaFold

Q8K441

Predicted Effect

probably benign
Transcript: ENSMUST00000044003
AA Change: V1173D

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000035458
Gene: ENSMUSG00000044749
AA Change: V1173D

Domain	Start	End	E-Value	Type
Pfam:ABC2_membrane_3	28	416	1.4e-42	PFAM
low complexity region	484	495	N/A	INTRINSIC
AAA	506	691	1.13e-6	SMART
transmembrane domain	854	876	N/A	INTRINSIC
transmembrane domain	971	990	N/A	INTRINSIC
transmembrane domain	1005	1027	N/A	INTRINSIC
Blast:AAA	1041	1176	4e-21	BLAST
transmembrane domain	1191	1213	N/A	INTRINSIC
low complexity region	1243	1254	N/A	INTRINSIC
AAA	1312	1505	2.43e-6	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intracellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, and White). This encoded protein is a member of the ABC1 subfamily. Members of the ABC1 subfamily comprise the only major ABC subfamily found exclusively in multicellular eukaryotes. This gene is clustered among 4 other ABC1 family members on 17q24 and may play a role in macrophage lipid homeostasis. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 55 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2700081O15Rik	T	A	19: 7,422,256	I456N	probably damaging	Het
Ace	A	T	11: 105,972,379	M327L	probably benign	Het
Bcl2l2	C	T	14: 54,884,379		probably benign	Het
Bicdl2	C	T	17: 23,666,017	Q231*	probably null	Het
Brms1l	A	T	12: 55,866,053	D277V	possibly damaging	Het
Cd38	C	A	5: 43,901,448	L135M	probably damaging	Het
Col6a3	G	T	1: 90,810,621	P1059T	possibly damaging	Het
Coro1c	A	T	5: 113,848,597	M262K	probably benign	Het
Cpxm2	G	T	7: 132,057,695	P481Q	possibly damaging	Het
Dnah12	G	T	14: 26,829,329	V2543F	probably benign	Het
Dock2	A	C	11: 34,273,698	D1145E	probably damaging	Het
Elf3	G	A	1: 135,254,352	R364W	probably damaging	Het
Eln	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	AGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCGGGGACACCAGCACCAGCCCCAAATCCAGGGACACCAGC	5: 134,711,081		probably benign	Het
Epha3	A	G	16: 63,773,560	I55T	probably damaging	Het
Fam69c	G	A	18: 84,730,046		probably benign	Het
Gfer	C	A	17: 24,694,285	D198Y	probably damaging	Het
Gm10436	A	T	12: 88,176,083	I450N	probably benign	Het
Gm11568	A	T	11: 99,858,184	T72S	unknown	Het
Gm21994	C	T	2: 150,255,146	R121Q	probably benign	Het
Gm5415	A	C	1: 32,546,033	I265M	probably damaging	Het
Igkv3-1	C	T	6: 70,704,069	A84V	probably benign	Het
Il1rl2	A	C	1: 40,343,119	Y197S	probably damaging	Het
Il2ra	T	C	2: 11,680,336	I161T	possibly damaging	Het
Itgb8	C	T	12: 119,166,772	R667H	probably benign	Het
Kcnh7	G	A	2: 62,837,194	Q334*	probably null	Het
Lctl	A	C	9: 64,133,216	R480S	possibly damaging	Het
Lrba	T	G	3: 86,315,430	I617S	possibly damaging	Het
Marf1	G	T	16: 14,114,201	H1651N	probably benign	Het
Mitf	T	A	6: 97,993,196	Y142N	probably damaging	Het
Olfr569	A	G	7: 102,887,628	V175A	probably benign	Het
Olfr620	T	A	7: 103,611,772	I194F	possibly damaging	Het
Pecam1	A	G	11: 106,671,750	V708A	probably benign	Het
Pinlyp	C	T	7: 24,542,440		probably null	Het
Polh	G	A	17: 46,175,248	R382W	probably damaging	Het
Prdm10	A	G	9: 31,327,474	I221V	probably benign	Het
Pskh1	G	T	8: 105,913,090	R134L	probably benign	Het
Ptpre	A	G	7: 135,651,995	N6D	probably benign	Het
Rasgrp4	C	T	7: 29,150,610	P58L	unknown	Het
Rhbdf2	G	T	11: 116,602,240	C393*	probably null	Het
Rlf	T	C	4: 121,182,691	I174M	possibly damaging	Het
Ryr2	T	A	13: 11,706,623	R2641*	probably null	Het
Simc1	A	G	13: 54,524,832	H331R	probably benign	Het
Skp2	A	G	15: 9,122,241	S256P	probably benign	Het
Smarcd2	T	C	11: 106,267,566	R10G	probably benign	Het
Spef2	A	G	15: 9,687,895	L480P	possibly damaging	Het
Tenm4	A	G	7: 96,873,874	H1541R	probably damaging	Het
Top1	T	A	2: 160,714,088	L489Q	probably damaging	Het
Ttll13	C	T	7: 80,254,097	H258Y	probably damaging	Het
Unc80	A	G	1: 66,483,349	R237G	possibly damaging	Het
Vmn1r55	A	G	7: 5,146,624	F267L	probably benign	Het
Vmn2r96	T	A	17: 18,597,868	M761K	possibly damaging	Het
Vps33a	G	A	5: 123,570,979	H58Y	possibly damaging	Het
Zfp354c	TCACACTCGGCACA	TCACA	11: 50,815,240		probably benign	Het
Zfp467	T	C	6: 48,439,181	Q179R	probably damaging	Het
Zfp729a	A	T	13: 67,619,948	S721T	possibly damaging	Het

Other mutations in Abca6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00402:Abca6	APN	11	110184709	missense	probably damaging	1.00
IGL00569:Abca6	APN	11	110187049	missense	possibly damaging	0.88
IGL00737:Abca6	APN	11	110196997	splice site	probably benign
IGL01024:Abca6	APN	11	110197142	missense	probably benign
IGL01087:Abca6	APN	11	110191650	missense	probably benign	0.00
IGL01511:Abca6	APN	11	110244310	missense	probably benign	0.00
IGL01516:Abca6	APN	11	110218217	missense	possibly damaging	0.70
IGL01621:Abca6	APN	11	110184708	missense	probably damaging	1.00
IGL01749:Abca6	APN	11	110244224	missense	probably damaging	1.00
IGL01934:Abca6	APN	11	110188655	missense	probably benign	0.00
IGL02010:Abca6	APN	11	110219616	missense	probably benign	0.12
IGL02121:Abca6	APN	11	110182924	missense	probably benign	0.38
IGL02423:Abca6	APN	11	110219006	splice site	probably benign
IGL02428:Abca6	APN	11	110178792	missense	possibly damaging	0.81
IGL02491:Abca6	APN	11	110176968	utr 3 prime	probably benign
IGL02541:Abca6	APN	11	110212267	missense	probably damaging	1.00
IGL02792:Abca6	APN	11	110188681	missense	probably damaging	0.99
IGL02836:Abca6	APN	11	110248548	missense	probably damaging	1.00
IGL02965:Abca6	APN	11	110180613	missense	probably benign
IGL03094:Abca6	APN	11	110184112	missense	probably benign	0.03
IGL03109:Abca6	APN	11	110180347	missense	probably damaging	0.96
R0068:Abca6	UTSW	11	110182882	missense	probably damaging	1.00
R0142:Abca6	UTSW	11	110188641	missense	probably damaging	1.00
R0165:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R0254:Abca6	UTSW	11	110236789	missense	probably benign	0.16
R0598:Abca6	UTSW	11	110197154	missense	probably damaging	1.00
R0992:Abca6	UTSW	11	110211684	missense	probably damaging	1.00
R1386:Abca6	UTSW	11	110244255	missense	probably benign	0.02
R1642:Abca6	UTSW	11	110218281	missense	possibly damaging	0.73
R1673:Abca6	UTSW	11	110212339	missense	probably benign	0.01
R1792:Abca6	UTSW	11	110184044	missense	probably benign	0.00
R1813:Abca6	UTSW	11	110233845	splice site	probably benign
R1817:Abca6	UTSW	11	110219318	missense	probably benign	0.00
R1842:Abca6	UTSW	11	110197039	missense	probably benign	0.00
R1898:Abca6	UTSW	11	110208799	missense	probably damaging	0.99
R1914:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1915:Abca6	UTSW	11	110212210	missense	probably benign	0.06
R1934:Abca6	UTSW	11	110210083	critical splice donor site	probably null
R1964:Abca6	UTSW	11	110184676	missense	probably damaging	0.98
R1967:Abca6	UTSW	11	110187148	missense	probably benign	0.09
R2127:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2128:Abca6	UTSW	11	110219649	missense	probably benign	0.00
R2164:Abca6	UTSW	11	110210193	frame shift	probably null
R2895:Abca6	UTSW	11	110202426	missense	probably benign	0.00
R3110:Abca6	UTSW	11	110178829	nonsense	probably null
R3111:Abca6	UTSW	11	110178829	nonsense	probably null
R3112:Abca6	UTSW	11	110178829	nonsense	probably null
R4094:Abca6	UTSW	11	110180366	missense	probably damaging	1.00
R4432:Abca6	UTSW	11	110241588	missense	probably benign	0.11
R4474:Abca6	UTSW	11	110233772	missense	possibly damaging	0.46
R4572:Abca6	UTSW	11	110216548	missense	probably benign	0.31
R4629:Abca6	UTSW	11	110230549	critical splice acceptor site	probably null
R4793:Abca6	UTSW	11	110191718	missense	probably benign
R4852:Abca6	UTSW	11	110244203	missense	probably benign	0.09
R4867:Abca6	UTSW	11	110202379	missense	probably benign	0.01
R4879:Abca6	UTSW	11	110219700	missense	probably damaging	0.98
R4918:Abca6	UTSW	11	110180551	missense	probably damaging	1.00
R5060:Abca6	UTSW	11	110219604	missense	possibly damaging	0.90
R5062:Abca6	UTSW	11	110177066	missense	probably benign	0.12
R5083:Abca6	UTSW	11	110218967	missense	probably damaging	1.00
R5173:Abca6	UTSW	11	110191720	missense	probably benign
R5393:Abca6	UTSW	11	110244295	missense	probably benign	0.00
R5484:Abca6	UTSW	11	110184073	missense	probably damaging	1.00
R5498:Abca6	UTSW	11	110208844	missense	possibly damaging	0.95
R5503:Abca6	UTSW	11	110218257	missense	probably damaging	1.00
R5645:Abca6	UTSW	11	110250408	missense	probably damaging	0.99
R5680:Abca6	UTSW	11	110236645	missense	possibly damaging	0.88
R5761:Abca6	UTSW	11	110210101	missense	probably damaging	1.00
R5779:Abca6	UTSW	11	110184670	missense	probably benign	0.37
R5818:Abca6	UTSW	11	110219643	missense	probably damaging	1.00
R6282:Abca6	UTSW	11	110208824	missense	probably damaging	0.98
R6455:Abca6	UTSW	11	110241581	missense	probably damaging	1.00
R6826:Abca6	UTSW	11	110216605	missense	probably benign	0.15
R6857:Abca6	UTSW	11	110219688	missense	possibly damaging	0.63
R6914:Abca6	UTSW	11	110190238	missense	probably benign
R6931:Abca6	UTSW	11	110244328	missense	probably benign	0.27
R7222:Abca6	UTSW	11	110191693	missense	probably benign	0.29
R7242:Abca6	UTSW	11	110241653	missense	possibly damaging	0.47
R7297:Abca6	UTSW	11	110183026	critical splice donor site	probably null
R7387:Abca6	UTSW	11	110202420	missense	probably benign
R7420:Abca6	UTSW	11	110250477	missense	probably benign	0.24
R7494:Abca6	UTSW	11	110208745	missense	possibly damaging	0.93
R7603:Abca6	UTSW	11	110180258	missense	possibly damaging	0.69
R7637:Abca6	UTSW	11	110218952	missense	probably benign	0.00
R7674:Abca6	UTSW	11	110219297	missense	probably damaging	1.00
R7753:Abca6	UTSW	11	110184107	missense	probably damaging	1.00
R7800:Abca6	UTSW	11	110187872	missense	probably benign	0.00
R7842:Abca6	UTSW	11	110196697	missense	possibly damaging	0.76
R8119:Abca6	UTSW	11	110197104	missense	probably benign	0.00
R8139:Abca6	UTSW	11	110184133	missense	probably damaging	1.00
R8176:Abca6	UTSW	11	110244194	missense	probably benign	0.01
R8179:Abca6	UTSW	11	110245274	missense	probably damaging	1.00
R8197:Abca6	UTSW	11	110211815	missense	probably damaging	0.99
R8241:Abca6	UTSW	11	110188630	missense	probably null	1.00
R8404:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8429:Abca6	UTSW	11	110202382	missense	probably benign
R8502:Abca6	UTSW	11	110219319	missense	probably damaging	0.99
R8816:Abca6	UTSW	11	110236687	missense	probably benign	0.04
R8964:Abca6	UTSW	11	110248537	missense	probably benign	0.00
R9153:Abca6	UTSW	11	110216655	missense	possibly damaging	0.61
R9233:Abca6	UTSW	11	110191670	missense	probably benign	0.31
R9407:Abca6	UTSW	11	110202384	nonsense	probably null
R9412:Abca6	UTSW	11	110212233	missense	probably damaging	0.99
R9453:Abca6	UTSW	11	110247264	critical splice donor site	probably null
R9533:Abca6	UTSW	11	110211756	missense	probably benign	0.16
R9546:Abca6	UTSW	11	110244216	nonsense	probably null
R9650:Abca6	UTSW	11	110180620	missense	probably benign	0.32
R9702:Abca6	UTSW	11	110216552	missense	probably damaging	1.00
R9709:Abca6	UTSW	11	110211763	missense	probably benign	0.01
X0024:Abca6	UTSW	11	110244255	missense	probably benign	0.02
X0064:Abca6	UTSW	11	110197142	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- GCTGTGGCTTCTAATAGCATTC -3'
(R):5'- GTGGGAAACTGTGGAAGCTGTC -3'

Sequencing Primer
(F):5'- CATGTGTACCATTTTTGTAAAGTGCC -3'
(R):5'- AAACTGTGGAAGCTGTCATTTG -3'

Posted On

2019-12-20