Incidental Mutation 'R8022:Uvssa'
ID 617439
Institutional Source Beutler Lab
Gene Symbol Uvssa
Ensembl Gene ENSMUSG00000037355
Gene Name UV stimulated scaffold protein A
Synonyms D330017J19Rik, 4933407H18Rik
MMRRC Submission 067461-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R8022 (G1)
Quality Score 225.009
Status Not validated
Chromosome 5
Chromosomal Location 33535893-33577098 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 33566848 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Glutamine at position 515 (L515Q)
Ref Sequence ENSEMBL: ENSMUSP00000085170 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087864] [ENSMUST00000202046] [ENSMUST00000202816]
AlphaFold Q9D479
Predicted Effect probably damaging
Transcript: ENSMUST00000087864
AA Change: L515Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000085170
Gene: ENSMUSG00000037355
AA Change: L515Q

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202046
AA Change: L515Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144025
Gene: ENSMUSG00000037355
AA Change: L515Q

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
low complexity region 495 506 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202816
AA Change: L515Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144400
Gene: ENSMUSG00000037355
AA Change: L515Q

DomainStartEndE-ValueType
low complexity region 97 113 N/A INTRINSIC
coiled coil region 169 199 N/A INTRINSIC
low complexity region 282 295 N/A INTRINSIC
coiled coil region 363 388 N/A INTRINSIC
Pfam:DUF2043 504 610 6e-43 PFAM
low complexity region 613 625 N/A INTRINSIC
low complexity region 648 662 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene appears to be involved in ubiquitination and dephosphorylation of RNA polymerase II subunits that stall after UV irradiation. The encoded protein interacts with several members of the nucleotide excision repair complex, and is thought to be involved in the transcription-coupled nucleotide excision repair (TC-NER) pathway to help remove lesions in the DNA that block transcription. Defects in this gene can cause UV-sensitive syndrome 3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,361,915 (GRCm39) T1386S probably benign Het
AI661453 T G 17: 47,777,161 (GRCm39) S296A unknown Het
Ambp G T 4: 63,062,434 (GRCm39) N268K probably damaging Het
Ankrd11 T C 8: 123,614,332 (GRCm39) K2503E probably damaging Het
Ap1g1 C A 8: 110,559,367 (GRCm39) R221S possibly damaging Het
Ap5z1 T C 5: 142,455,904 (GRCm39) probably null Het
Aspa A C 11: 73,213,032 (GRCm39) N103K probably benign Het
Bend7 G A 2: 4,757,590 (GRCm39) V211I probably benign Het
Bsn A G 9: 107,991,603 (GRCm39) M1383T probably benign Het
Cad G T 5: 31,226,150 (GRCm39) V1117F probably damaging Het
Cdh2 A G 18: 16,723,358 (GRCm39) L856S probably damaging Het
Cdh20 T A 1: 109,988,838 (GRCm39) S247T probably benign Het
Ces1b A G 8: 93,795,943 (GRCm39) probably null Het
Chd7 T A 4: 8,751,605 (GRCm39) V34E unknown Het
Clca3a2 A T 3: 144,511,527 (GRCm39) F623I probably damaging Het
Cope T G 8: 70,765,453 (GRCm39) M217R probably benign Het
Crim1 T A 17: 78,622,984 (GRCm39) I394N possibly damaging Het
Crnkl1 A T 2: 145,760,486 (GRCm39) I644N probably damaging Het
Cry1 G A 10: 84,982,266 (GRCm39) A360V probably damaging Het
Ctcfl A T 2: 172,960,559 (GRCm39) V8D probably benign Het
Cyp2d34 G A 15: 82,500,315 (GRCm39) Q475* probably null Het
Cyp39a1 T C 17: 44,057,468 (GRCm39) Y436H probably damaging Het
Cyp3a25 T A 5: 145,914,478 (GRCm39) Q484L probably benign Het
Dnah1 A G 14: 30,986,971 (GRCm39) F3607S probably damaging Het
Dnali1 T A 4: 124,959,323 (GRCm39) K23N possibly damaging Het
Ecel1 T C 1: 87,081,052 (GRCm39) I313V probably benign Het
Ehhadh C A 16: 21,596,570 (GRCm39) A53S probably benign Het
Epcam T C 17: 87,953,736 (GRCm39) S277P probably benign Het
Fbxo10 T C 4: 45,062,062 (GRCm39) I155V possibly damaging Het
Fgd6 A T 10: 93,880,206 (GRCm39) K353N possibly damaging Het
Glce A T 9: 61,967,873 (GRCm39) M426K probably benign Het
Glmp A T 3: 88,233,827 (GRCm39) N228I probably damaging Het
Gm4787 C A 12: 81,424,494 (GRCm39) V555F possibly damaging Het
Gm5114 T A 7: 39,058,800 (GRCm39) H273L probably benign Het
Gzmg T A 14: 56,394,903 (GRCm39) T122S probably benign Het
Hace1 T C 10: 45,577,066 (GRCm39) V820A probably damaging Het
Igf2r T A 17: 12,937,682 (GRCm39) D535V probably damaging Het
Kcnd3 A G 3: 105,366,189 (GRCm39) M20V probably benign Het
Kcnn3 T G 3: 89,517,010 (GRCm39) I473S possibly damaging Het
Klhl35 T A 7: 99,122,446 (GRCm39) F94Y unknown Het
Kmt2c C T 5: 25,486,678 (GRCm39) V4712I possibly damaging Het
Lepr A G 4: 101,639,754 (GRCm39) E740G probably benign Het
Lmod3 T C 6: 97,225,260 (GRCm39) D187G probably benign Het
Lsm3 C T 6: 91,496,543 (GRCm39) H49Y probably benign Het
Lypd10 T A 7: 24,413,599 (GRCm39) I205N possibly damaging Het
Magi1 T C 6: 93,674,346 (GRCm39) S962G probably damaging Het
Man2b1 G A 8: 85,822,242 (GRCm39) R782Q probably damaging Het
Mical2 A T 7: 111,902,974 (GRCm39) K148N probably damaging Het
Nbeal1 C T 1: 60,299,431 (GRCm39) Q1256* probably null Het
Ncam1 G T 9: 49,476,192 (GRCm39) A299D possibly damaging Het
Ncapg A G 5: 45,839,136 (GRCm39) D512G probably damaging Het
Nkiras2 A G 11: 100,515,113 (GRCm39) N28D probably benign Het
Nprl2 A C 9: 107,420,260 (GRCm39) K53T probably damaging Het
Nr4a3 T A 4: 48,051,510 (GRCm39) I88N probably damaging Het
Oas3 A G 5: 120,895,031 (GRCm39) I986T possibly damaging Het
Or6c76 A T 10: 129,612,654 (GRCm39) L305F possibly damaging Het
Pcsk1 A T 13: 75,247,412 (GRCm39) Y187F possibly damaging Het
Pgc A G 17: 48,039,701 (GRCm39) T32A probably benign Het
Ranbp2 A C 10: 58,321,683 (GRCm39) D2660A possibly damaging Het
Retreg1 A G 15: 25,843,565 (GRCm39) R46G Het
Rrbp1 C A 2: 143,798,712 (GRCm39) K1100N probably benign Het
Rsph10b A T 5: 143,904,050 (GRCm39) T676S probably benign Het
Setdb1 A T 3: 95,245,910 (GRCm39) F672I probably damaging Het
Setdb1 T A 3: 95,254,396 (GRCm39) D195V probably damaging Het
Slc12a8 A G 16: 33,445,456 (GRCm39) E450G probably benign Het
Slc1a7 G A 4: 107,869,473 (GRCm39) V513M probably benign Het
Slc25a12 A T 2: 71,105,533 (GRCm39) V667E unknown Het
Slc39a3 T C 10: 80,867,111 (GRCm39) T212A probably benign Het
Slc45a1 C T 4: 150,722,766 (GRCm39) G373S possibly damaging Het
Snx11 G A 11: 96,663,680 (GRCm39) T53M probably damaging Het
Snx33 A G 9: 56,832,624 (GRCm39) F482L possibly damaging Het
Srebf2 C T 15: 82,062,966 (GRCm39) R468C probably damaging Het
Stk32a C T 18: 43,448,166 (GRCm39) Q382* probably null Het
Sun3 C A 11: 8,973,376 (GRCm39) S167I probably damaging Het
Sycp2 A G 2: 177,996,855 (GRCm39) L1116P probably damaging Het
Thbs4 T G 13: 92,888,955 (GRCm39) T913P probably damaging Het
Trav8d-1 C T 14: 53,016,284 (GRCm39) Q57* probably null Het
Trio C G 15: 27,749,952 (GRCm39) V2250L probably benign Het
Unc119b A T 5: 115,265,102 (GRCm39) I204N probably damaging Het
Usp4 A G 9: 108,255,670 (GRCm39) E576G probably damaging Het
Xkr8 T C 4: 132,459,649 (GRCm39) Y43C probably damaging Het
Xpo6 G A 7: 125,768,426 (GRCm39) L94F probably benign Het
Zbtb11 A G 16: 55,826,383 (GRCm39) K804R probably damaging Het
Zfp616 A G 11: 73,974,894 (GRCm39) R479G probably benign Het
Zfp661 T C 2: 127,419,844 (GRCm39) T99A probably benign Het
Zfp839 A T 12: 110,821,532 (GRCm39) Q115H probably damaging Het
Zyg11a C T 4: 108,046,765 (GRCm39) probably null Het
Other mutations in Uvssa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Uvssa APN 5 33,566,192 (GRCm39) missense probably benign 0.00
IGL02136:Uvssa APN 5 33,549,192 (GRCm39) missense probably damaging 1.00
IGL02339:Uvssa APN 5 33,572,193 (GRCm39) missense probably damaging 1.00
IGL03096:Uvssa APN 5 33,568,268 (GRCm39) missense probably benign 0.29
IGL03130:Uvssa APN 5 33,549,189 (GRCm39) missense possibly damaging 0.57
IGL03248:Uvssa APN 5 33,549,160 (GRCm39) missense probably damaging 1.00
blinkered UTSW 5 33,547,096 (GRCm39) missense probably benign 0.04
lowbrow UTSW 5 33,571,228 (GRCm39) splice site probably benign
BB001:Uvssa UTSW 5 33,568,295 (GRCm39) missense probably damaging 1.00
BB011:Uvssa UTSW 5 33,568,295 (GRCm39) missense probably damaging 1.00
PIT1430001:Uvssa UTSW 5 33,559,914 (GRCm39) missense possibly damaging 0.50
PIT4142001:Uvssa UTSW 5 33,549,428 (GRCm39) missense probably benign 0.05
R0326:Uvssa UTSW 5 33,566,191 (GRCm39) missense probably benign 0.01
R0443:Uvssa UTSW 5 33,546,168 (GRCm39) missense possibly damaging 0.68
R1438:Uvssa UTSW 5 33,571,228 (GRCm39) splice site probably benign
R1474:Uvssa UTSW 5 33,546,165 (GRCm39) missense probably benign 0.00
R1521:Uvssa UTSW 5 33,571,278 (GRCm39) missense probably damaging 0.99
R1522:Uvssa UTSW 5 33,545,152 (GRCm39) missense probably damaging 1.00
R1839:Uvssa UTSW 5 33,547,096 (GRCm39) missense probably benign 0.00
R2223:Uvssa UTSW 5 33,549,407 (GRCm39) missense probably damaging 1.00
R3404:Uvssa UTSW 5 33,547,162 (GRCm39) missense probably damaging 0.99
R3405:Uvssa UTSW 5 33,547,162 (GRCm39) missense probably damaging 0.99
R3406:Uvssa UTSW 5 33,547,162 (GRCm39) missense probably damaging 0.99
R3892:Uvssa UTSW 5 33,547,096 (GRCm39) missense probably benign 0.04
R4624:Uvssa UTSW 5 33,547,300 (GRCm39) missense possibly damaging 0.87
R4898:Uvssa UTSW 5 33,571,257 (GRCm39) nonsense probably null
R5413:Uvssa UTSW 5 33,568,252 (GRCm39) missense probably damaging 1.00
R5921:Uvssa UTSW 5 33,547,096 (GRCm39) missense probably benign 0.00
R5977:Uvssa UTSW 5 33,547,204 (GRCm39) missense probably damaging 1.00
R6198:Uvssa UTSW 5 33,566,854 (GRCm39) missense probably damaging 1.00
R6566:Uvssa UTSW 5 33,549,520 (GRCm39) missense possibly damaging 0.66
R6884:Uvssa UTSW 5 33,566,461 (GRCm39) splice site probably null
R7924:Uvssa UTSW 5 33,568,295 (GRCm39) missense probably damaging 1.00
R8196:Uvssa UTSW 5 33,568,311 (GRCm39) missense probably benign 0.07
R8252:Uvssa UTSW 5 33,549,523 (GRCm39) missense probably benign 0.00
R9104:Uvssa UTSW 5 33,571,404 (GRCm39) missense probably damaging 0.99
R9208:Uvssa UTSW 5 33,571,419 (GRCm39) critical splice donor site probably null
R9276:Uvssa UTSW 5 33,572,180 (GRCm39) missense possibly damaging 0.89
R9320:Uvssa UTSW 5 33,547,365 (GRCm39) missense probably benign 0.20
R9658:Uvssa UTSW 5 33,568,333 (GRCm39) missense probably damaging 1.00
R9723:Uvssa UTSW 5 33,547,382 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACAGCTCAGGCCCAATGTAG -3'
(R):5'- TTGTTAGGAGGATCTCAGAACTG -3'

Sequencing Primer
(F):5'- GTATATTAATGCTGATCCCAGGCTTC -3'
(R):5'- GAACTGAGTTTTAGCTATTCCTTCAC -3'
Posted On 2020-01-23